... 49 of 76CONSOLIDATED LIST OF FINANCIAL SANCTIONS TARGETS IN THE U K 11/01/2013http://financialsanctions-prd/Report _ Viewer.asp Koumkal, Kumkal, Merlin and Tinet. In custody in France as of ... of a Taliban council that coordinates the collection of zakat (Islamic tax) from Baluchistan Province, Pakistan. Head of Taliban Financial Commission. Associated with Mullah Mohammed Omar. Listed ... Qarabagh District, Ghazni Province (2) Andar District, Ghazni Province, Afghanistan Page 1 of 76CONSOLIDATED LIST OF FINANCIAL SANCTIONS TARGETS IN THE U K 11/01/2013http://financialsanctions-prd/Report _ Viewer.asp ...
Ngày tải lên: 23/03/2014, 02:20
... primitive acts of Schank's conceptual dependency theory, discussions of wnlch can be found in [10,11]. The Object Primitive CONNECTOR Is used to indicate classes of actions (described in terms ... larger context, some causal inference mechanism forces us (as human understanders) to find the common interpretation in the process of connecting these two events causally. In interpreting this ... between inferred concepts and concepts already stored In Its ~emory. However, the Inference mecnanlsms used were in no way dlrected speclflcally to tne task of making connections between concepts...
Ngày tải lên: 21/02/2014, 20:20
List of non-governmental organizations in consultative status with the Economic and Social Council ppt
... (1998) Institute of Internal Auditors (1989) Institute of International Social Development (2000) Institute of International Sociology of Gorizia (2006) Institute of Marine Engineering, Science ... (2005) Academy of Criminal Justice Sciences (1983) Academy of Mining Sciences (2004) Action aides aux familles demunies (2002) Action Canada for Population and Development (2004) Action contre ... American Society of Criminology (2002) American Society of International Law (1993) American Society of Safety Engineers (2002) American Society of the Italian Legions of Merit (2009) American...
Ngày tải lên: 23/03/2014, 21:20
myler, weeks - the pocket hanbook of image processing algorithms in c
Ngày tải lên: 05/06/2014, 12:05
Báo cáo y học: " In-vitro antiviral activity of Solanum nigrum against Hepatitis C Virus" pdf
Ngày tải lên: 11/08/2014, 21:21
Tài liệu Pro WPF in C# 2010 pdf
... 220 Application Tasks 222 Showing a Splash Screen 222 Handling Command-Line Arguments 223 Accessing the Current Application 224 Interacting Between Windows 225 Single-Instance Applications ... graphical effects. In practice, you might choose to scale down complex effects in the user interface, depending on the level of hardware acceleration that’s available in the client (as indicated by ... Hierarchy of Resources 295 Static and Dynamic Resources 297 Nonshared Resources 299 Accessing Resources in Code 299 Application Resources 300 System Resources 301 Resource Dictionaries 302 Creating...
Ngày tải lên: 13/02/2014, 20:20
Tài liệu THE ROLES OF AMINO ACID CHELATES IN ANIMAL NUTRITION pdf
... Paul Cuplin 27. THE USE OF ZINC AMINO ACID CHELATES IN HIGH CALCIUM AND PHOSPHORUS DIETS OF RAINBOW TROUT 424 Ronald W Hardy and Karl D. Shearer 28. THE EFFECTS OF IRON AMINO ACID CHELATE IN CULTURE ... APPROACH TO MAXIMIZING CARCASS LEANNESS 269 David Altherton SECTION 4 POULTRY 17. THE EFFECT OF AMINO ACID CHELATES IN CHICK MORTALITY 291 David Atherton 18. THE DYNAMICS OF FEEDING AMINO ACID CHELATES TO BROI LERS ... continued) 15 ENZYME II III IV V Aerobic transhydrogenases Amine oxidase Cu,Fe PO., Mo, Fe (flavin containing) Amine oxidase Cu Co PO. CN,Ca (copper containing) Xanthine oxidase Mo,Fe PO. CN,Cu Aldehyde oxidase Me NH., W Aldehydmutase Mo Anaerobic transelectronases NADPH dehydrogenase PO. NADH dehydrogenase Fe++, PO. CN Cu,Zn,Mn, Ca,~,P04' P 2 0 " V Aerobic transelectronases Cytochrome...
Ngày tải lên: 15/02/2014, 16:20
Tài liệu PCR-RFLP ANALYSIS OF BETA-LACTOGLOBULIN GENE IN MURRAH BUFFALOES pdf
... dairy cattle. Milk protein genes such as k-casein and b- lactoglobulin are associated with milk production performance and have a major in uence on the composition of milk and on the processing ... Animal Sciences, 3:150-155 Meignanalakshmi,A., Mahalinga Nainar,A and Nachimuthu,K. (2001). Identification of genetic polymorphism of beta- lactoglobulin gene locus in Red Sindhi cows by PCR-RFLP ... protein genetic polymorphisms have evoked considerable research interest in recent years because of possible association between milk protein genotypes and economically important traits in...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Báo cáo khoa học: "Some Uses of Higher-Order Logic in Computational Linguistics" pdf
... rewritten as the following: role R :- prim_role R. concept C :- prlm_concept C. concept (and CI C2 ) :- concept C1 , concept C2 . concept (restr R CI) :- concept Cl, role R. subsume C C. subsume A ... prim_concept commander. prim_concept message. prim_concept important message. role R :- prim_role R. concept C :- prim_concept C. concept (X\(CI X & C2 X)) :- concept CI, concept C2 concept ... should ac- tually simplify the process of finding proofs. In a more specific sense, there are sublogics of a higher-order logic in which the process of constructing proofs is not much more complicated...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Neural retina leucine-zipper regulates the expression of Ppp2r5c, the regulatory subunit of protein phosphatase 2A, in photoreceptor development pdf
... dsDNA (oligonucleotides for the rho promoter, 5Â-ATC TCG CGG ATG CTG AAT CAG CCT CTG GC-3Â and 5Â-GCC AGA GGC TGA TTC AGC ATC CGC GAG AT-3Â; oli- gonucleotides for the Ppp2r 5c promoter, 5Â-CCC TGA AGC CAG ... rhodopsin and Ppp2r 5c promoter-spe- ci c primers (rhodopsin, forward, 5Â-ATG AGA CAC CCT TTC CTT TCT-3Â; rhodopsin, reverse, 5Â-GTA GAC AGA GAC CAA GGC TGC-3Â; Ppp2r 5c, forward, 5Â-CCC TCT AAG AGC ... GAG CCG CAG GGA AAG-3Â and 5Â-TGG AGC TC G CTG ATT GGC CAG AAG CTG CAA- 3Â) was used for the following EMSA assay. The DNAặpro- tein binding reaction was conducted in a mixture including 10Ã binding...
Ngày tải lên: 06/03/2014, 02:20
Export Performance Measurement: An Evaluation of the Empirical Research in the Literature pdf
... objective financial data or because of the difficulty in rec- onciling cross-national or cross-industrial differences in accounting practices, variations in exchange rates, and financial reporting ... businesses, especially in cross country studies, complicated because of differences in accounting and sales-recording procedures (Styles 1998). The relevance and importance of performance dimensions ... into account the variability of performance in which some ventures are successful and others unsuccessful. Furthermore, this approach has been criticized because of the difficulty of associating...
Ngày tải lên: 06/03/2014, 21:20
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... by PCR using oligonucleotide primers Aprom (forward): 5Â-CGC ATC GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C- 3Â, and Acod (reverse): 5Â-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA ... a concomitant increase in PG -C1 6:0, which may be compen- satory in this case [28]. As reported for the formation of the trimeric LHCII antenna in C. reinhardtii,thefattyacid C1 6:1(3t) could increase ... multimolecular complexes. These complexes contain numerous proteins from chloroplast or nucleo-cytosolic origin and various associated cofactors including chlorophyll, carotenoid pigments and redox components...
Ngày tải lên: 07/03/2014, 15:20
THE ECONOMIC BENEFITS OF IMPROVING LITERACY SKILLS IN THE WORKPLACE pdf
... Traditionally, business and government focused on finding ways to boost economic growth by increasing consumer spending, creating a climate that encourages business investment, and improving Canada's ... the introduction of increasingly sophisticated and effective interventions to bring about improvements in literacy in the workplace. Early work in the literacy field defined literacy as a condition ... higher incidence of training and education enjoyed by individuals with higher literacy skills is significant. Weighting the average annual incomes (from all sources) associated with each of these...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: Protein and mRNA content of TcDHH1-containing mRNPs in Trypanosoma cruzi pdf
... subunit (Tc00.1047053510993. 10),F,5Â-ACAACGTGCAAAGGCTTCTT-3 Â;R,5Â-CTC GTGCCAACTCCAAGTTT-3Â. PCR, using a Bio-Cycler II thermocycler (Peltier Thermal Cycler; Bio-Rad, Hercules, CA, USA), included ... (Tc00.1047053509891.40),F,5Â-GCCG TCATGCAAAAATATCC-3Â;R,5Â-CCTTTTCAGCCAA AAAGCTG-3Â; putative glucose-regulated protein 78 (Tc00.1047053506585.40),F,5Â-TGGCGGTAAGAAGAA GCAGT-3Â;R,5Â-CCGAGGTCAAACACAAGGAT-3Â; putative ... 5Â-TGGGGAGGATTATAGCGATG-3Â;R,5Â-ACTTC GGCAGAGCACTTCAT-3Â; putative mucin TcMUCII (Tc00.1047053506131.20),F,5Â-GCGGAGAACAAGATG AGGA-3Â;R,5Â-TCGCTTTTGAAATAGGCACC-3Â; hypothetical protein (Tc00.1047053509891.40),F,5Â-GCCG TCATGCAAAAATATCC-3Â;R,5Â-CCTTTTCAGCCAA AAAGCTG-3Â;...
Ngày tải lên: 15/03/2014, 23:20
Health Council of the Netherlands Undernutrition in the elderly pdf
... regards clinical picture, care setting and psychosocial characteristics (loneliness, grief and depression). The primary outcome measures of the research are clinically relevant effects (mortality, ... reached about the other clinically relevant outcome measures: the number of RCTs and their size are too small for this. Conclusion In conclusion the Committee states that the state of science ... absence of trials, it is unclear whether causality exists in these associations. The cut-off points are equally poorly scientifically justified. For this reason, the meaning of these characteristics...
Ngày tải lên: 22/03/2014, 13:20
Source Identification of Volatile Organic Compounds in Houston, Texas pdf
... kernel component is acetic acid. Acetic acid is a typical photochemical reaction product (30), so the wind direction plot shows a relatively smooth shape.Meanwhile, a number of anthropogenicacetic acid ... anthropogenic acetic acidsources. Source 8 is characterized by c9 -benzenes and c1 0- benzenes. A number of c9 - and c1 0-benzenes emitters (e.g., the operation units of chemical or petrochemical plants) ... larger volume of air as wind speed increases; the concentration therefore decreases (16). However, the factors of sources 2 and 9increase withincreasing wind speed and source3 shows an almost flat curve....
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: The N-glycans of yellow jacket venom hyaluronidases and the protein sequence of its major isoform in Vespula vulgaris pdf
... anchor used to synthesize the cDNA for the RACE PCR had the sequence 5Â-AAGCAGTGG TATCAACGCAGAGTACT30VN-3Â. The RACE PCR was then conducted by using the forward primer 5Â-ACAT TCCTACTCACTTTTGCCACAACT ... 5Â-ACAT TCCTACTCACTTTTGCCACAACT TCGGCGTCT AT-3Â and a mixture of the reverse universal primers 5Â-CTAATA CGACTCACTATAGGGCAAGCAGTGGTATCAACGCA GAGT-3Â and 5Â-CTAATACGAC-TCACTATAGGGC-3Â, at a ratio of 1 : 40 w ... which also contain this carbohydrate determinant [21]. Especially in the case of such ‘plant-allergic’ patients, a positive in vitro test against insect venoms can be expected to be unassociated with...
Ngày tải lên: 23/03/2014, 15:20
Tình hình nước bị ô nhiễm arsenic ở trên thế giới (The situation of polluted arsenic water in the world) pdf
Ngày tải lên: 25/03/2014, 05:20
Báo cáo khoa học: "THE EXPRESSION OF LOCAL RHETORICAL RELATIONS IN INSTRUCTIONAL TEXT*" pdf
Ngày tải lên: 31/03/2014, 06:20