lipid metabolism metabolic syndrome and cancer

... the future, for treatment and prevention of obesity and diabetes and other diseases The investigation of effects of plant extracts on activity of lipid- carbohydrate metabolic enzymes such as ... effective for treatment of human obesity and, possibly diabetes [2] Anti-hyperlipidemic and anti-diabetic effect of metformin were showed, but side-effect and its efficacy of remains in debate if ... out to assess anti-obesity, anti-diabetic effects and the expression of activity of some lipidcarbohydrate metabolic enzymes in experimental obese and diabetic mice The aim of this study is to elucidate...

Ngày tải lên: 14/03/2014, 10:20

... and precursor to DM), increased levels of cholesterol and triglycerides, lipodystrophy, and the onset or complication of diabetes[18,60] HIV, Metabolic Syndrome, and Heart Disease Metabolic Syndrome ... may increase the risk of metabolic syndrome (the clustering of abdominal obesity, hyperglycaemia, dyslipidaemia and hypertension) and thus predispose to type diabetes and cardiovascular disease[6,7,9,11,17,18] ... composition on lipid metabolism[ 62] The syndrome consists of both metabolic abnormalities (hyperlipidaemia and IR) and body fat redistribution (central adiposity and peripheral fat wasting) Central...

Ngày tải lên: 11/08/2014, 14:21

... hypertension, dyslipidemia and obesity are often associated with hyperglycemia or overt T2DM (4, 5) Clusters of these conditions have been termed metabolic syndrome (MetS), and patients with MetS and/ or ... Diabetes Mellitus, Metabolic Syndrome and Cardiovascular Disease Glucagon-like Peptide and Systemic Glucose Regulation Glucagon-like Peptide and the Heart Glucagon-like ... coronary blood flow and metabolism (oxygen supply/demand) is being intensely investigated and therapies that act to rebalance this relationship are primary goals in the treatment and management of...

Ngày tải lên: 24/08/2014, 12:16

... in lean, metabolic syndrome (MetS), and metabolic syndrome aerobically exercise trained (XMetS) Ossabaw swine .109 Figure 4.2 Correlation study among plasma aldosterone, A1R and PCNA ... prevents micro- and macrovascular disease in porcine model of hypercholesterolemia and coronary artery disease 1.3 Metabolic syndrome Atherosclerosis is increased 2-4-fold in metabolic syndrome (MetS) ... dysfunction in dyslipidemic swine, and A1R and/ or A2A/BR might contribute to the changes Aldosterone regulation of A1R contributes to coronary atherosclerosis in metabolic syndrome, and is mitigated...

Ngày tải lên: 24/08/2014, 13:30

... Respiration and Lipid Metabolism RESPIRATION IN INTACT PLANTS AND TISSUES Many rewarding studies of plant respiration and its regulation have been carried out on isolated organelles and on cell-free ... Respiration and Lipid Metabolism 249 by the presence of specific proteins, called oleosins, that coat the surface and prevent the phospholipids of adjacent oil bodies from coming in contact and fusing ... structural lipids, including sphingolipids and sterols (see Chapter 13), but these are minor components Other lipids perform specific roles in photosynthesis and other processes Included among these lipids...

Ngày tải lên: 07/03/2014, 20:20

... gstk-1 and ⁄ or gstk-2 silencing on lipid metabolism, we measured the following lipid fractions: phospholipids, diglycerides, triglycerides, free or esterified cholesterol, free fatty acids and total ... potential role of gstk-1 and ⁄ or gstk-2 on the lipid composition of worms For this purpose, phospholipids, diglycerides, triglycerides, free and esterified cholesterol, and free and total fatty acid ... our expression data for GSTK-1 and GSTK-2 supported peroxisomal and mitochondrial localizations, we further investigated cellular functions, such as lipid metabolism and oxygen consumption, which...

Ngày tải lên: 16/03/2014, 03:20

... (mg/dl)f ≥ 100 ≥ 100 ≥ 110 a Metabolic syndrome if three of five criteria are met Metabolic syndrome if waist circumference plus two criteria are met c Metabolic syndrome if waist circumference ... with and without the metabolic syndrome Schizophr Res 2005, 80:9-18 Bobes J, Arango C, Aranda P, Carmena R, Garcia-Garcia M, Rejas J: CLAMORS Study Collaborative Group Cardiovascular and metabolic ... [http://www.idf.org/webdata/docs/ MetSyndrome_FINAL.pdf] 14 Examination Committee of the Criteria for Metabolic Syndrome in Japan: Definition and criteria of the metabolic syndrome in Japan [in Japanese]...

Ngày tải lên: 09/08/2014, 01:21

... the metabolic syndrome (dyslipidaemia, hypertension, hyperglycaemia, and central obesity) as well as the metabolic syndrome itself documented Information regarding GC (oral prednisolone) dose and ... metabolic syndrome and GC exposure, thus acting as potential confounders, included age (P = 0.001 and P = 0.002, respectively), RA disease duration (P = 0.008 and P < 0.001), ESR (P = 0.006 and ... components of the metabolic syndrome (high TG and hypertension), but not any of the other components (low HDL, obesity, and glucose intolerance) or the presence of the metabolic syndrome itself...

Ngày tải lên: 09/08/2014, 01:22

... Clearfield M; 4S Group and the AFCAPS/TexCAPS Research Group: The metabolic syndrome and risk of major coronary events in the Scandinavian Simvastatin Survival Study (4S) and the Air Force/Texas ... diabetes mellitus, hypertension and hyperlipidaemia (syndrome X): relation to reduced fetal growth Diabetologia 1993, 36:62-67 Reilly MP, Rader DJ: The metabolic syndrome: more than the sum of ... obesity: impact on glucose tolerance and plasma lipoprotein and lipid levels in men J Clin Endocrinol Metab 2005, 90:1434-1439 22 Ford ES: Prevalence of the metabolic syndrome defined by the International...

Ngày tải lên: 09/08/2014, 10:23

... the metabolic syndrome (dyslipidaemia, hypertension, hyperglycaemia, and central obesity) as well as the metabolic syndrome itself documented Information regarding GC (oral prednisolone) dose and ... metabolic syndrome and GC exposure, thus acting as potential confounders, included age (P = 0.001 and P = 0.002, respectively), RA disease duration (P = 0.008 and P < 0.001), ESR (P = 0.006 and ... components of the metabolic syndrome (high TG and hypertension), but not any of the other components (low HDL, obesity, and glucose intolerance) or the presence of the metabolic syndrome itself...

Ngày tải lên: 09/08/2014, 13:22

... Clock gene leads to metabolic syndrome in mice [12], and in humans Clock polymorphisms have been associated with obesity and metabolic syndrome [13,14] Cellular metabolic states can serve as ... ACAAGGAGCCGGGTTCTG and the reporter sequences CTTGGGCATTTTCAT and TTGG GC GTTTTCAT for PER2 10870, and GCTCAGCAGCAGCCT GAA and CGAAACTGCGACTGGTCTGATT and the reporter sequences CTTGCTACAAGTATCTC and TTGCTACAGGTATCTC ... contribute to the routine seasonal variations and to the metabolic syndrome Our earlier finding that seasonality was associated with the metabolic syndrome [20], gave a rationale for the current...

Ngày tải lên: 10/08/2014, 09:20

... baseline and at month-3 At baseline, patient demographics and characteristics were recorded At both visits, vital and physical parameters were collected, and fasting blood samples were drawn and analyzed ... hypertension (16.7%), lipid metabolism disorder (6.7%) and diabetes (5.6%) appeared moderate compared to numbers from German primary care patients (hypertension 31.6%, lipid metabolism disorder ... antihypertensives, antidiabetics and lipid lowering drugs and was therefore regarded the more sensitive instrument At baseline, New-Typ had a significantly higher prevalence than New-Olz and New-Risp, but not...

Ngày tải lên: 11/08/2014, 16:20

... DecisionPath for Metabolic Syndrome International Diabetes Center Master DecisionPath for Metabolic Syndrome Fat Mass International Diabetes Center Role of Obesity In Metabolic Syndrome • • TNF-α ... – Statins and Fibrates ? International Diabetes Center Treating Dyslipidemia in Children and Adolescents* A Rational Clinical Approach Age 2-10 years > 10 year Normal Lipid Panel No lipid management ... PROBLEM - Obesity (and insulin resistance) in children – a worldwide epidemic - Great risk of Metabolic Syndrome and/ or Type Diabetes at an earlier age - Great risk of medical morbidity and disability...

Ngày tải lên: 12/08/2014, 20:58

... Diabetes Prevention - Diagnosis Preventions Prediabetes (IFG -IGT) & Metabolic Syndrome Preventions Prediabetes (IFG -IGT) & Metabolic Syndrome Diagnosis Fasting glucose > 126 mg/dL (7 mmol/L) or Diagnosis ... Diabetes Prevention - Diagnosis Preventions Prediabetes (IFG -IGT) & Metabolic Syndrome Preventions Prediabetes (IFG -IGT) & Metabolic Syndrome Diagnosis Fasting glucose > 126 mg/dL (7 mmol/L) or Diagnosis ... Nutrition Therapy for Dyslipidemia • Physical activity and weight loss – modest decrease in TRI and increase in HDL • Fat < 30% total calories – Saturated fat

Ngày tải lên: 12/08/2014, 20:58

... Epidemic of Obesity and Metabolic Syndrome 20 Coronary Blood Flow in Metabolic Syndrome 22 Metabolic Syndrome and Coronary Ion Channels 26 Hypothesis and Investigative Aims ... receptors and ion channels that are downregulated in metabolic syndrome are depicted in green Factors, receptors and pathways that are upregulated in metabolic syndrome are depicted in blue and/ or ... by metabolic syndrome as evidenced by the significant reduction in percent repayment of incurred coronary flow debt (i.e repayment/debt ratio) * P < 0.05 vs lean-control 25 Metabolic Syndrome and...

Ngày tải lên: 24/08/2014, 11:10

... STEATOHEPATITIS, AND CORONARY ATHEROGENESIS IN METABOLIC SYNDROME Risk of coronary artery disease (CAD), the leading cause of death, greatly increases in metabolic syndrome Metabolic syndrome (MetS; ... methyl esters and fatty acid metabolism in metabolic syndrome, coronary artery disease, and non-alcoholic steatohepatitis 64 Predictive dyslipidemia, non-alcoholic steatohepatitis, and coronary ... (102) 2) neointimal structure and thrombosis cascade mimic and humans (103), 3) omnivorous diet and lipid metabolism similar to humans, 4) docile and sedentary behavior, and 5) size Miniature swine...

Ngày tải lên: 24/08/2014, 12:40

... inflammatory markers and plasma amino acids and insulin resistance, after controlling for obesity 1.9 Dyslipidemia in the metabolic syndrome- The atherogenic lipoprotein phenotype 1.9.1 Lipid metabolism ... resistance 28 1.9 Dyslipidemia in the metabolic syndrome- The atherogenic lipoprotein 29 Phenotype 1.10 The APOA1/C3/A4/A5 locus and dyslipidemia 34 Chapter AIMS 39 Chapter STUDY POPULATIONS AND METHODS ... metabolic syndrome, and its link to obesity, insulin resistance is an important part of it Through the studies described in this thesis, we have shown that the metabolic syndrome is common, and...

Ngày tải lên: 12/09/2015, 10:42

... glycerophospholipid to yield arachidonic acid and lysophospholipid 58 SECTION II 40-41 X List of Figures Figure 2.3.1.2 Metabolism of sphingomyelin and sphingolipids 59 Figure 2.3.3.1 Western blots ... such as prostaglandins and leukotrienes (Dennis, 1994) On the other hand, phospholipids including phosphatiylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine ... the thymus and other lymphoid organs such as spleen and lymph nodes (Shakhov et al., 2000) sPLA2-IID suppresses the proliferation of CD4+ and CD8+ and inhibit the development of colitis and multiple...

Ngày tải lên: 04/10/2015, 17:04

... Lipid Metabolism (TRAO ĐỔI LIPID) I Đại cương lipid: Định nghĩa: Lipid hợp chất axit béo với ancol aminoacol Hàm lượng: Trong thể sống Lipid dự trữ mô mỡ chiếm từ ... sphingozin, đường + Các Lipid phức tạp khác: Sulfolipit, aminolipit, lipoprotein MỘT SỐ AXIT BÉO SINH HỌC QUAN TRỌNG II TRAO ĐỔI LIPID: (Lipid Metabolism) Năng lượng phân giải Lipid: Phân giải chất ... thủy phân Lipid tạp 2.3 Sự phân giải glixeril Nhờ enzyme glixerin kinase xúc tác, glixeril thành 15 glixerril-3 phosphat, sau bị oxy hóa tiếp thành glixerrandehit-3-phosphat Glixerrandehit-3-phosphat...

Ngày tải lên: 18/08/2012, 21:03

... Hutchinson and H Kerr Graham Index 241 Geoff Sheean The measurement of spasticity 64 Garth R Johnson and Anand D Pandyan Physiotherapy management of spasticity 79 Roslyn N Boyd and Louise Ada Seating and ... intentionally left blank Upper Motor Neurone Syndrome and Spasticity Second Edition Upper Motor Neurone Syndrome and Spasticity Clinical Management and Neurophysiology Second Edition Edited by ... techniques and surgery We have also stressed the importance of adequate measurement techniques and, indeed, Chapter has been completely rewritten by Garth R Johnson and Arnand D Pandyan We hope...

Ngày tải lên: 21/09/2012, 11:02