... associated to kappa light chain multiple myeloma Treatment with thalidomide 100 mg/day and dexamethasone 40 mg on days 1–4 every 28 days was started, a peritoneal catheter was inserted, and the patient ... they are defined as non-amyloid immunoglobulin light chains, and are mostly kappa chains They cause renal failure and extra-renal manifestations usually secondary to heart, liver and peripheral ... of packed red cells were transfused, a central venous catheter was inserted, and haemodialysis was started Proteinuria was g/day and urine sediment analysis showed haematuria Serum glucose was...
Ngày tải lên: 11/08/2014, 10:23
... inflammatory reactions in celiac disease [5] In celiac disease, autoantibody reactivity to transglutaminase (tTG2) has been shown to closely correlate with the acute phase of the disease Immune reactivity ... http://www.jmedicalcasereports.com/content/3/1/68 Scott BB, Losowsky MS: Coeliac disease: a cause of various associated diseases? Lancet 1975, 2:956-957 M'saddek F, Gaha K, Ben Hammouda R, Ben Abdelhafidh ... microsomes (ALKM-1), antimitochondrial antibody (AMA), and anti-liver cytosol antigen antibody (ALC-1), were negative The serum gammaglobulin level was normal A gluten free diet was advised At a month...
Ngày tải lên: 11/08/2014, 20:20
Characterization of plasma myosin heavy chain in zebrafish as an important factor for ompa mediated anti phagocytic function
... 5'-GACGAGAACTTTTTGCGCCTCGTTATC3' dnrev 5'-GGGTACCCCGTCACCAACGACAAAA-3' A2 -for 5'-CGGAATTCAAAAAGACAGCTATCGATTG-3' A2 -rev 5'-TGCGGCCGCAGCCTGCGGCTGAGTTAC-3' 36 down-rev, both of which were introduced into a KpnI restriction ... has active complement system and can be activated via three different pathways: the classic pathway, the alternative pathway and the lectin pathway, which are similar to mammals (Holland & Lambris, ... (ICAM-1) The upregulation of ICAM-1 is crucial for the pathogenesis and is depended on PKC-alpha and PI3-kinase signaling and NF-κB activation (Prasadarao, 2002; Selvaraj, et al, 2007) In addition,...
Ngày tải lên: 03/10/2015, 20:32
Social Phobia as a Disease
... rather sweeping assertions of ‘‘brain abnormalities.’’ Sheehan (1986) advocates a broadly similar approach Although in his book The anxiety disease social phobia is broached tangentially À as ... ‘ disease ’ ought to be limited to material disease only The definition of disease by distress and maladjustment is, according to him, a metaphoric one, arrived at by analogy The reasoning is as ... contentious and broader in scope than the similarly undefined term disease. ) The third strategy, which so far as I am aware has never yet been adopted, at least for a psychiatric classification, is...
Ngày tải lên: 01/11/2013, 08:20
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt
... mentioning that, especially in higher animals (mammals and also in frogs and fishes), an aspartate (aspartic acid 248 in human 4F2hc; aspartic acid 380 in Fig as both the N-terminal and transmembrane segments ... Takata H, Kuriki T, Okada S, Takesada Y, Iizuka M, Minamiura N & Imanaka T (1992) Action of neopullulanase Neopullulanase catalyzes both hydrolysis and transglycosylation at a- (1 fi 4)- and a- (1 ... trehalose-6phosphate hydrolase; ASU, amylosucrase; SPH, sucrose phosphorylase; IMSY, isomaltulose synthase; TSY, trehalose synthase; CMD, cyclomaltodextrinase; MGA, maltogenic amylase; NPU, neopullulanase;...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... clinically important Fabry disease- associated a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... Therapeutics is currently in Phase II clinical trials for Fabry disease [18,19] A thorough review of a- galactosidase A pharmacologic chaperones for Fabry disease is provided in an accompanying...
Ngày tải lên: 18/02/2014, 16:20
Cancer as a metabolic disease pdf
... 14:1-15 Amuthan G, Biswas G, Ananadatheerthavarada HK, Vijayasarathy C, Shephard HM, Avadhani NG: Mitochondrial stress-induced calcium signaling, phenotypic changes and invasive behavior in human ... 2009 Accepted: 27 January 2010 Published: 27 January 2010 References Anand P, Kunnumakkara AB, Sundaram C, Harikumar KB, Tharakan ST, Lai OS, Sung B, Aggarwal BB: Cancer is a preventable disease ... 241 Yasunaga M, Ohishi Y, Nishimura I, Tamiya S, Iwasa A, Takagi E, Inoue T, Yahata H, Kobayashi H, Wake N, Tsuneyoshi M: Ovarian undifferentiated carcinoma resembling giant cell carcinoma of...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: Catalytic digestion of human tumor necrosis factor-a by antibody heavy chain pot
... arrows Cleavage at Gln21-Ala22 gave a band at 15 kDa in SDS ⁄ PAGE Cleavages at Leu36-Leu37 and Asn40-Gly41 gave a band at 13 kDa The cleaved Gln21-Ala22 and Asn40-Gly41 bonds are in loops and are ... 17 D’Alessandria C, Malviya G, Viscido A, Aratari A, Maccioni F, Amato A, Scopinaro F, Caprilli R & Signore A (2007) Use of a 99mTc labeled anti-TNFalpha monoclonal antibody in Crohn’s disease: ... of catalytic antibody light and ⁄ or heavy chains capable of the degradation of urease in Helicobacter pylori The catalytic antibody light chain, UA15-L, could suppress the number of bacteria infecting...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... metal dyshomeostasis in all aspects is clear In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial increase in the levels of extracellular metals and a decrease...
Ngày tải lên: 07/03/2014, 10:20
Milk Diet As A Remedy For Chronic Disease- p1 potx
... size, it has a decided advantage in ease of absorption “This breed can be traced back for 2,000 years and was always famous for dairy purposes In temperament, these animals are quiet and docile, ... standard against any agent or condition that may attempt to alter it And when temporarily or accidentally that standard may be departed from, we see immediately an attempt to repair the damage ... next day start with the milk as early as usual, again stop at noon, and eat a somewhat heartier meal in the evening, if the appetite calls for it Another meal that may be taken the first day is...
Ngày tải lên: 15/03/2014, 00:20
Psoriasis – A Systemic Disease Edited by Jose O''''Daly pot
... Guatemala City, Guatemala, and in hospitals in San Salvador, El Salvador, and San Josộ, Costa Rica was analyzed Guatemalan patients were either from the clinic of Guatemalan Association against ... psoriasis (Chandran et al., 2010) 6.5 Psoriatic arthritis and cardiovascular disease Immune-mediated inflammatory diseases (IMIDs), including RA and SpA, are associated with increased cardiovascular ... and treat the disease, has advanced as a result of significant collaborative efforts by rheumatologists and dermatologists (Mease, 201 0a) For many years the concept of PsA as a separate disease...
Ngày tải lên: 23/03/2014, 16:21
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart ... Scale (Lawton 1975) Balance was evaluated using the Functional Reach (Duncan et al 1990) and One Leg Stance Test (Vellas et al 1997) Walking velocity was assessed by tracking a reflective marker ... Hackney et al Adherence to an exercise program may be more likely if it is novel and enjoyable A study of those at risk of heart failure found that the waltz was just as good as traditional aerobic...
Ngày tải lên: 28/03/2014, 20:20
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc
... Biochim Biophys Acta 1780, 914–920 Tamamura H, Imai M, Ishihara T, Masuda M, Funakoshi H, Oyake H, Murakami T, Arakaki R, Nakashima H, Otaka A et al (1998) Pharmacophore identification of a chemokine ... peptide (plastic support or beads), as well as on soluble ECL2 peptide Increasing stringency was applied in all selection campaigns, i.e decreasing input phage titers and increasing washing steps ... phageÆmL)1) Substrate containing Eu-W8044-labeled streptavidin and biotin–cAMP was added and incubated for h at room temperature The LANCE signal was recorded at 665 nm and compared with cAMP...
Ngày tải lên: 28/03/2014, 22:20
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... that IL-2, as well as other common gamma chain (gc; also known as CD132) signaling, are important stimulatory signals for the development, function and fitness of nTreg cells Its signaling cascade...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... however, exactly how fAβ activates the astrocytic NADPH oxidase remains unclear [29,70] Abramov and colleagues have examined a potential role for astrocytic NADPH oxidase-derived ROS in fAβdependent ... a fAβdependent manner [31] A detailed examination of the mechanisms subserving oxidase activation has revealed that upon fAβ stimulation, the Vav guanine nucleotide exchange factor (GEF) is a...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
Ngày tải lên: 20/06/2014, 04:20
PSORIASIS – A SYSTEMIC DISEASE ppt
... Guatemala City, Guatemala, and in hospitals in San Salvador, El Salvador, and San Josộ, Costa Rica was analyzed Guatemalan patients were either from the clinic of Guatemalan Association against ... psoriasis (Chandran et al., 2010) 6.5 Psoriatic arthritis and cardiovascular disease Immune-mediated inflammatory diseases (IMIDs), including RA and SpA, are associated with increased cardiovascular ... and treat the disease, has advanced as a result of significant collaborative efforts by rheumatologists and dermatologists (Mease, 201 0a) For many years the concept of PsA as a separate disease...
Ngày tải lên: 27/06/2014, 09:20
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a direct ... in autoimmunity are available from patients with RA Initially, Edwards and Cambridge reported on five patients with refractory RA, all of whom had major improvement in disease activity and achieved ... joint-specific autoimmune disease Nat Immunol 2002, 3:360-365 Felson DT, LaValley MP, Baldassare AR, Block JA, Caldwell JR, Cannon GW, Deal C, Evans S, Fleischmann R, Gendreau RM, Available online http://arthritis-research.com/content/5/3/131...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx
... obtained was used as a template for real-time quantitative polymerase chain reaction, which was performed with the LC FastStart DNA Master SYBR GreenI® (Roche Diagnostics, Mannheim, Germany) in a LightCycler® ... receptors and are activated by lipopolysaccharide J Exp Med 2003, 197:403-411 Nagai Y, Akashi S, Nagafuku M, Ogata M, Iwakura Y, Akira S, Kitamura T, Kosugi A, Kimoto M, Miyake K: Essential role ... Freeman GJ: The B7-CD28 superfamily Nat Rev Immunol 2002, 2:116-126 20 Matsuyama T, Yamada A, Kay J, Yamada KM, Akiyama SK, Schlossman SF, Morimoto C: Activation of CD4 cells by fibronectin and anti-CD3...
Ngày tải lên: 09/08/2014, 01:23