... nitrogen and stored at -80°C or fixed in 4% paraformaldehyde and routinely embedded in paraffin Frozen liver samples were used for PECAM1 immunohistochemistry and were processed as described [16] For ... cyclophilin Standard curves of serial dilutions from total RNA were used for transforming the ct-values in concentration values depicted as arbitrary units For primer design of total M-Pk and M2-Pk ... used for sequencing of RT-PCR-products of cell lines and isolated cells were marked M-Pk-up and M-Pk-down For real time quantification of total M-Pk primer pair (M-Pk-f1 (gcatcatgctgtctggagaa and...
Ngày tải lên: 13/08/2014, 13:20
... (anti-sense) for b-actin The PCR conditions were as follows: for c-IAP-1 and XIAP, 94°C for min, 62°C for min, and 72°C for min; for Bcl-2, 94°C for 30 s, 62°C for 30 s, 72°C for 10 s; and for b-actin: ... study, and participated in its design and coordination DX contributed effort in designing, performing, and analyzing the results and conclusion All authors read and approved the final manuscript ... both dose- and time-dependent manners (Figure 2B, C, D) The IC 50 values at 24, 48, 72, and 96 h were 230.5, 86.9, 60.0, and 35.7 μM for KG1a, 68.5, 46.6, 28.8, and 23.5 μM for Kasumi-1, and 58.3,...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo y học: " DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines" ppt
... Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN, UK Authors’ contributions JTB, JKPr, and YG wrote the paper and interpreted the results JKPr and YG designed ... P-value threshold The association analyses and FDR calculations were performed for all autosomal principal components and CpG-sites in the methylation data, and for all autosomal genes in the RNA-sequencing ... Przeworski, and Stephens labs for helpful discussions We acknowledge the ENCODE Project for providing publicly-available histone modification and DNase data (collected by the Bernstein and Crawford...
Ngày tải lên: 09/08/2014, 22:23
báo cáo khoa học: "ShRNA-mediated gene silencing of MTA1 influenced on protein expression of ER alpha, MMP-9, CyclinD1 and invasiveness, proliferation in breast cancer cell lines MDA-MB-231 and MCF-7 in vitro" pptx
... amplified products were 130 bp The PCR cycling program was 94° for minutes, 25 cycles at 94°C for seconds, 56.5°C for seconds, 72°C for 20 seconds, and a final extension at 72°C for 10 the PCR products ... minutes, then 35 cycles at 94°C for 30 seconds, 58.5°C for 45 seconds, 72°C for 90 seconds, and a final extension at 72°C for 10 The control was 18SrRNA (GeneBank, NO X67238), the forward and reverse ... curve and MTT analysis for MDA-MB-231 and MCF-7 cells A: cells growth curve analysis for MDA-MB-231 and MCF-7 cells B: MTT analysis for MDA-MB-231 and MCF-7 cell compared to blank control group and...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "Biochemical and morphological changes in endothelial cells in response to hypoxic interstitial edema" pdf
... with PBS before centrifugation at 100,000 g for 20 at 4°C These membrane fractions were collected and called PMC (for control), PMH3 and PMH5 (for and hours of hypoxia) respectively, and aliquots ... contributions 20 LB and EB performed the biochemical studies; RD performed the morphometric studies; GM and PP conceived the study, participated in design and coordination and gave their contribution ... control (ct), after and h of hypoxia and cardiogenic edema The W/D ratio was 4.98 ± 0.3 in control conditions (average data from zero time and sham for h), 5.12 ± 0.1 and 5.16 ± 0.2 at and h of hypoxia...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: "Thymic plasmacytoid dendritic cells are susceptible to productive HIV-1 infection and efficiently transfer R5 HIV-1 to thymocytes in vitro" pdf
... antibodies for the immunohistochemistry and participated in the design of the study SRL participated in the design and coordination of the study and revised the manuscript PUC participated in the design ... Human blood and thymic DC were infected with R5 or X4 HIV-1 for h and then washed to remove any unbound virus The HIV-1-exposed blood and thymic DC were then cultured for 24 h before adding an ... Boronia, Australia) for 20 at 4°C and finally washed and incubated with streptavidin-APC (Becton Dickinson, Franklin Lakes, NJ, USA) for 25 at 4°C Blood and thymic DC purification For thymic DC purification,...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Dendritic cell-mediated HIV-1 transmission to T cells of LAD-1 patients is impaired due to the defect in LFA-1" docx
... molecule and its natural cell surface ligand LFA1 J Virol 2004, 78:12062-12065 Anderson ME, Siahaan TJ: Targeting ICAM-1/LFA-1 interaction for controlling autoimmune diseases: designing peptide and ... control LAD-1/variant 100 10 1 days LAD-1 and LAD-1/variant T cells form smaller clusters with DC DC attract T cells and form large clusters in vivo and in vitro, a process that is dependent ... (9.1 versus 5.6 and 6.2 in arbitrary units for LAD-1 and the variant respectively; p < 0.001 and
Ngày tải lên: 13/08/2014, 09:20
Dendritic cells respond differently to live and killed bacteria molecular mechanisms of pathogen recognition by dendritic cells and implications for vaccine development
... generating random and highly diverse BCRs and TCRs by somatic gene recombination The interaction of the BCR and TCR with antigens activates the B and T cells leading to proliferation and the generation ... countries, and account for several hundred million cases of diarrhoea and several ten of thousand deaths each year (11) ETEC was thought to account for approximately 200 million diarrhoea episodes and ... washed times (for R&D kit) or times (for BD and ebioscience kits) For R&D and eBioscience kits, 100l biotinylated detection antibody diluted in Reagent Diluent was added into each well For BD kit,...
Ngày tải lên: 14/09/2015, 08:24
Analysis and compensation of log_domain filter deviations due to transistor nonidealities
... parasitic emitter and base resistances, finite beta, Early effect, and area mismatches SPICE simulations, both large and small-signal andysis, are perforrned to verify the results By understanding the ... enthusiasm in teaching, and tireless effort in ensuring our work is presented with precision and clarity am deeply grateful to the many memben of the MACS lab for providing a stimulating and supportive ... 4- Models for (a) a dissipative inductor and (b) a dissipative capacitor 61 4-2 Nonideal models for (a) an inductor and (b) a capacitor It shows both the component tolerance and the parasitic...
Ngày tải lên: 06/11/2012, 10:35
Children’s Health Deficits due to Diarrhoea: Effects of Water Supply and Sanitation Systems in Slums with Different Water Logging Conditions
... LHT LMK PDL PHS PSM NCD Hand washing with soap before eating Hand washing without soap before eating No hand washing before eating Hand washing after defecation with soap Hand washing after defecation ... in verandah Households with children defecating in latrine Hygiene practices Hand washing with soap before eating Hand washing without soap before eating No hand washing before eating Hand washing ... Short-term and Rainy, SHU: Short-term and Heavy rainy, SDG: Short-term and Drainage, LSD: Long-term and Stagnant, LHT: Long-term and Heavy rainy, LMK: Long-term and Monsoon flood, PDL: Persistent and...
Ngày tải lên: 05/09/2013, 10:15
Energy savings due to daylight and artificial lighting integration in office buildings in hot climate
... includes: - Design, Supervise, Maintain and Operate the following Systems: Architectural Systems (i.e Walls, Roofs and Windows) and Building lighting system - Design and Operate with Considerations ... Furthermore, the program has been widely validated for accuracy and consistency and offers a great capability for simulating a wide range of design features and energy conservation measures, including ... window's design is employed Acknowledgements The authors would like to express their gratitude and thanks to King Fahd University of Petroleum and Minerals for its continuous support and for the...
Ngày tải lên: 05/09/2013, 16:10
The NCI Strategic Plan for Leading the Nation To Eliminate the Suffering and Death Due to Cancer pdf
... behavior modifications, environmental and policy influences, medical and nutritional approaches, and training and education for research and health professionals We will support and conduct studies ... prevention and control For more infor comprehensive education and training program in mation, go to cancer.gov/prevention/pob cancer prevention and control at the graduate and For information ... coordinate and optimize information and data sharing This integration and support for the preclinical and clinical testing of cancer interventions will accelerate selection and development of candidate...
Ngày tải lên: 15/03/2014, 00:20
Health Education to Villages: An integrated approach to reduce childhood mortality and morbidity due to diarrhoea and dehydration; Maharashtra, India 2005 – 2010 pptx
... lead a life forever handicapped by a childhood of hunger, illness, and both physical and mental underdevelopment Behind all our efforts is the sense that every life has enormous value, and every ... supplemented and supported by booklets, leaflets, posters and informational guides in Marathi and English, and made freely available at health worker stations, hospitals, schools, and more No claim for ... need for separate toilets for boys and girls, together with a hand-washing facility in every school in Maharashtra Usage of Soap and Water ― Promote the habit of washing hands with soap and water...
Ngày tải lên: 22/03/2014, 15:21
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx
... IL-6, TNFa, VEGF, and GM-CSF (p
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Complement component C5a Promotes Expression of IL-22 and IL-17 from Human T cells and its Implication in Age-related Macular Degeneratio" potx
... without C5a and C5aR antagonist for days Cell supernatants were assayed for IL-1b, IL-6 and TNFa expression (F) Monocytes and T cells were sorted and cultured with or without C5a for day Cell ... from AMD patients and controls were treated with or without C5a and a C5aR antagonist for days Cell supernatants from 14 controls and 14 AMD patients were used for ELISA analysis and are presented ... Figure IL-1b and IL-6 secreting monocytes are important for C5a induced IL-22 and IL-17 expression form T cells (A) CD3+CD4+ T (T) cells and CD3-CD14+ monocytes (M) were sorted and cultured with...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon Anaemia virus" ppt
... pre-denaturation at 95°C for 30 s followed by 50 cycles of 95°C for 5s, 59°C for 10s, 72°C for 10s, and data acquisition at 80°C for 2s Melting curve analysis was performed from 70°C to 95°C ... 108.16 TCID50/ml for NBISA01, and 107.16TCID50/ml for HKS-36 CHSE-214 cell monolayers in 25 cm2 tissue culture flasks, each inoculated with ml of virus, were monitored daily for CPE and were harvested ... free water and µl was used in real-time RT-PCR The assay was performed on three replicates of each virus sample The thermal conditions were one cycle of reverse transcription at 55°C for 30 min,...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Constitutive expression of Atlantic salmon Mx1 protein in CHSE-214 cells confers resistance to Infectious Salmon Anaemia virus" docx
... pre-denaturation at 95°C for 30 s followed by 50 cycles of 95°C for 5s, 59°C for 10s, 72°C for 10s, and data acquisition at 80°C for 2s Melting curve analysis was performed from 70°C to 95°C ... 108.16 TCID50/ml for NBISA01, and 107.16TCID50/ml for HKS-36 CHSE-214 cell monolayers in 25 cm2 tissue culture flasks, each inoculated with ml of virus, were monitored daily for CPE and were harvested ... free water and µl was used in real-time RT-PCR The assay was performed on three replicates of each virus sample The thermal conditions were one cycle of reverse transcription at 55°C for 30 min,...
Ngày tải lên: 20/06/2014, 04:20