letter of reference from a teacher

Ngày tải lên: 16/10/2013, 10:15

Ngày tải lên: 18/10/2013, 16:15

Ngày tải lên: 24/01/2014, 06:20

Ngày tải lên: 24/01/2014, 06:20

Ngày tải lên: 24/01/2014, 06:20

... 21 participants with a range of characteristics including age (median age 63 (range 36–79)), marital status, place of residence and gynecological diagnosis (Table 1) All characteristics in Table ... knowledgeable person On the other hand it seemed all could take advantage of the feeling of trust in a healthcare professional in the early part of a cancer trajectory If a participant did not have ... physicians, also had close relations to a healthcare professional (family or friend), hereafter labeled “closely related healthcare professionals” Trust in a closely related healthcare professional...

Ngày tải lên: 13/02/2014, 06:20

... dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at mm phosphate At 121 Temperature effects on hibernator PFK allostery ... probably due to temperature alone Sensitivity to adenylates (ATP inhibition, AMP and ADP activation) was reduced when the enzyme was assayed at °C, a temperature characteristic of hibernation, as ... 37 °C was 7.2 The concentration of Mg.ATP was held at 0.5 mM All other assay conditions are detailed in the Materials and methods Data are means ± SEM, n ¼ separate determinations Temperature...

Ngày tải lên: 19/02/2014, 16:20

... produce plasmids pSIB1-Cd and pSIB1 -a3 +Cd, respectively The sequences of the 5¢ PCR primers were 5¢-AGAGAGAA TTCATATGTCAGATTTGTTCAG-3¢ for N-domain+, 5¢CTGAAAACGCTAAGCATATGGGTATTACGA-3¢ for C-domain–, ... [14] from psychrophilic bacteria consist of a heat labile domain and a heat stable domain Bentahir et al [13] have proposed that a heat labile domain provides a sufficient flexibility around the active ... unfolding has been observed for cold-adapted a- amylase and family xylanase from an Antarctic bacterium [20,21] The apparent optimal temperatures of these proteins for enzymatic activities are much...

Ngày tải lên: 23/03/2014, 13:20

... cervical SCI Acknowledgements This work was part of a project financed by FISCAM (Fundación para la Investigación Sanitaria de Castilla-La Mancha, Spain) which does not have any commercial interest ... to the analysis and acquisition of the data AAE contributed to the analysis and acquisition of the data EPR contributed to the software development All authors read and approved the manuscript ... was completed satisfactorily, a static calibration recording was made Using the static calibration recording, we checked that each marker was visible to at least one of the scanning cameras at...

Ngày tải lên: 19/06/2014, 08:20

... Page of Table Results of JAK2V617F Tests Sample Types and Diagnosis Number of total samples Number of V617F+ samples Percentage of V617F+ samples Average ages of V617F- samples Average ages of ... Leukemia 2010, 24:1128-38 Shide K, Shimoda HK, Kumano T, Karube K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada ... cross-contaminations Lane 11 did not give a clear PCR product and was excluded from further analysis Samples and are JAK2V617F-positive, while all the rest are JAK2V617F-negative Zhao et al Journal of...

Ngày tải lên: 10/08/2014, 21:23

... questionnaire, interview guide, and case study data collection plan We also engaged one individual from each of Africa, Asia, Europe, and Latin America to provide a very detailed review of the draft ... innovative nally by the Appraisal of Guidelines, Research and Evaluation in Europe (AGREE) collaboration, adapted one version of the questionnaire for organizations producing CPGs and HTAs and another ... finding that many organizations producing CPGs or HTAs conducted a focused review of one particular organization that they then emulated or a broad review of a variety of organizational models;...

Ngày tải lên: 11/08/2014, 16:21

... 3D models as a reasonable amendment in craniofacial reconstruction that offers multiple advantages They facilitate surgical planning by demonstrating the anatomical characteristics of the tissue ... operated upon By adding a haptic sensation, this approach optimizes preoperative planning The surgeon achieves a better impression of the anatomical situation, the actual amount of bone and the ... of specialized software systems, application of this technique is limited to larger medical centers The disadvantages are additional costs for software and computers and the additional time needed...

Ngày tải lên: 11/08/2014, 20:20

... The collagen matrix appears porose and knotty (Fig 6a and 6b) Page of Figure Collagen matrix, azan staining (100×): representative central area of pure collagen matrix With immuno-gold-labelling ... incubated for days As a sample, the total volume of buffer medium was extracted and analysed to avoid saturation of the buffer medium with free VEGF165 To differentiate between the initial degradation ... process of endochondral bone development and mediating bone vascularisation for normal differentiation of chondrocytes and osteoblasts An increase in VEGF is an indication of increased vascular permeability...

Ngày tải lên: 11/08/2014, 20:20

... frugal fruitful full fumbling functional funny fussy fuzzy F fabulous failing faint fair faithful fake false familiar famous fancy fantastic far faraway far-flung far-off G fast fat fatal fatherly ... rural rusty S sad safe salty same sandy sane sarcastic sardonic satisfied scaly scarce scared scary scented scholarly scientific scornful scratchy scrawny second secondary second-hand separate ... quintessential quirky quixotic quizzical R radiant ragged rapid rare rash raw recent reckless rectangular ready real realistic reasonable red reflecting regal regular reliable relieved remarkable remorseful...

Ngày tải lên: 07/08/2015, 15:10

... understandable - we all want to fit in and having an accent marks us as being from another place My students always asked me what the penalty was for having an accent on the IELTS speaking exam They ... information, go back to each paragraph and see if you can decipher what important information it contains Is it an important paragraph? Does it have essential information, or does it explain what ... set aside a time and place for listening practice Many of the audio materials on the IELTS are instructions This makes sense in the same way as the reading exam makes sense - a lot of what you...

Ngày tải lên: 13/06/2016, 09:10

... different reference standards Both a latent class and a composite reference standard approach suggested that the prevalence of TB in this group of patients was approximately 44%, and thus a relative ... cavities and unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a ... LCA led in this study to broadly similar sensitivity and specificity estimates of disease characteristics as two alternative reference standards: a composite reference standard, as well as an...

Ngày tải lên: 22/03/2014, 18:20

... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment ... medical-waste-recycling-products The community awareness of the danger of medical wastes should be raised through various ways, ranging from propaganda, education and dissemination of information ... – Biofast – a kind of machine for filtering liquid wastes Biofast are outstanding because of its effectiveness and efficiency Biofast operates automatically; therefore, it reduces the man-made...

Ngày tải lên: 23/09/2012, 15:38

... diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily...

Ngày tải lên: 03/11/2012, 11:44

... showed that the Case evaluation gave a higher discharge than in Case Kunimatsu et al (2006) calculated cv (coefficient of variation) values of the annual loads in Mano River (watershed area of 16.4 ... station by Japan Meteorological Agency (2008) Load Estimations Load evaluation of Case was calculated by water discharge and nutrient load from our only weekly research data (Table 1) In the Case ... of TP was avoided in this study Evaluation of phosphorus loads will require the establishment of a seasonally separated equation model that takes into account rainfall events and seasonal changes...

Ngày tải lên: 05/09/2013, 10:15

... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake...

Ngày tải lên: 05/09/2013, 10:15