less bioequivalence of plant provitamin a carotenoids

The A to Z of Plant Names: A Quick Reference Guide to 4000 Garden Plants

The A to Z of Plant Names: A Quick Reference Guide to 4000 Garden Plants

... glutinosa grey A incana green A viIidis hazel A selTulata Italian A cordata Japanese A japonica red A rubra Sitka A viIidis subsp sinuata thinleaf A incana subsp tenuif olia white A rhombifolia alecost ... alecost Tanacetum balsamita Alexanders Smyrniwl1 olusatrum Alisma L (Alismataceae) uh-liz-muh Water plantain Gk name for a water plant spp aquatic herbs Worldwide plantago-aquatica L plan- tay-gohuh-kwat-i-kuh ... trees E Asia to Australia allissima (Mill.) SWingle al-tis-i-muh Tree of heaven Lat tallest China air plant Kalanchoe pinnata A jania Poljakov (Asteraceae) uh-jah-nee-uh Of Ajan, E Russia 34 spp.,...

Ngày tải lên: 19/03/2014, 11:51

487 428 0
báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf

báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf

... resistance regulator The Plant Journal 2009, 58:578-591 Yasuda M, Ishikawa A, Jikumaru Y, Seki M, Umezawa T, Asami T, MaruyamaNakashita A, Kudo T, Shinozaki K, Yoshida S, Nakashita H: Antagonistic ... regression analysis of public microarray data sets Proceedings of the National Academy of Sciences of the United States of America 2005, 102:8633-8638 Hirai MY, Sugiyama K, Sawada Y, Tohge T, Obayashi ... downloaded from the TAIR website (ftp://ftp.arabidopsis.org/ Microarrays/analyzed_data/) This dataset consists of 1436 Affymetrix Arabidopsis 25K arrays obtained from NASCArrays and AtGenExpress All...

Ngày tải lên: 11/08/2014, 11:20

12 331 0
Identification of plant as a novel and alternative host model for burkholderia pseudomallei

Identification of plant as a novel and alternative host model for burkholderia pseudomallei

... GAATTCCTCGAACCGTCCATCGTC 60.0 KHWTTSS2P2 GGATCCGATCGTGTCGAACGAGATCA 60.0 KHWTTSS2P3 GGATCCGGCATCGACGGTATTCT 66.9 KHWTTSS2P4 AAGCTTATATCGCCGGGATAGCGTA 66.9 BTTTSS2P1 aaGAATTCGGTGGCCTCCAGAAACAGT ... (5’-3’) Annealing Temperature (oC) 60.7 KHWTTSS1P1 GAATTCCGAACCGCTTTGTGATAACC KHWTTSS1P2 GGATCCGATCTTGAGCAGATGCTTG 60.7 KHWTTSS1P3 GGATCCGCCACGATATCCTCGAAAAG 60.7 KHWTTSS1P4 CTGCAGAGCTACGCCGTGAACGTATT ... BTTTSS2P2 aaGGATCCGAGGACCCGCATGACAAG 55.0 BTTTSS2P3 GGATCCGTGTCGCATCTGAAGGTGTC 55.0 BTTTSS2P4 AAGCTTACGAGCTGGTCGTTGATCTC 55.0 BTTTSS3P1 TTGAATTCGCATTGCGCGTATTTCTTTT 56.0 BTTTSS3P2 TTGGATCCTGATCGACGACTTCAAGCAG...

Ngày tải lên: 09/10/2015, 10:49

119 420 0
Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot

Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot

... biochemical analyses reported above A Electron cryomicroscopy and image analysis of the two-dimensional arrays B Fig Analysis of polypeptide composition of grana preparation Comparison of (A) SDS ⁄ PAGE ... projection appearance of negatively stained dimeric PSII core arrays [14,37,39–41] The arrangement of the particles within the array is such that they are substantially separated from each other and ... treatment produced grana membranes free from stroma lamellae Among a range of detergent concentrations used, 0.1% a- DM allowed the isolation of a pelletable fraction that, upon negative staining, showed...

Ngày tải lên: 30/03/2014, 10:20

15 476 0
Tài liệu BIOCHEMICAL TARGETS OF PLANT BIOACTIVE COMPOUNDS A pharmacological reference guide to sites of action and biological effects doc

Tài liệu BIOCHEMICAL TARGETS OF PLANT BIOACTIVE COMPOUNDS A pharmacological reference guide to sites of action and biological effects doc

... paraguayensk (matC) (Aquifoliaceae), Coffea species (coffee) (Rubiaceae), Paullinia cupana (guarana) (Sapindaceae), Cola acuminata (cola) and Theabroma cacao (cocoa) (Sterculiaceae) and Camellia sinensis ... from Artemisia annua (Asteraceae) is of major importance as an antimalarial because of extensive resistance of Plasmnodiumfalciparum to antimalarials such as chloroquine Artemisinin in has a 3,12-peroxy ... (Lophophora williamsii (peyote) (Cactaceae) paralytic convulsant); (-)-salsolinol (IQ) (Musa paradisiaca (banana) (Musaceae) and Theobroma cacao (cocoa) (Sterculiaceae) dopamine antagonist linked...

Ngày tải lên: 17/02/2014, 05:20

861 443 0
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

... obtained on the basis of recombinantly produced PLDa2 from cabbage SAXS analysis (Fig 2) and analytic size exclusion chromatography indicate unequivocally that native PLDa2 from cabbage is a monomeric ... PLDa2 A typical SAXS profile of PLDa2 is shown for 4.7 mgÆmL)1 in Fig 2A From scattering intensities I(0), a molecular mass of 97 kDa was calculated (using BSA as standard), which is in accordance ... chiral environment of the aromatic amino acid side chains, has a defined structure that presents two sharp minima at 288 and 295 nm, and two maxima at 274–283 nm (wide) and 290 nm (sharp) Storage...

Ngày tải lên: 19/02/2014, 02:20

11 751 0
Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt

Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt

... performed according to that with DABY-inactivated GPAO [8] revealed that the pI value of the DAPY-inactivated GPAO was not dramatically changed The native GPAO is characterized by a pI of 7.2 [18] After ... characterization was prepared by a cyclic flux of DAPY solution through a hydroxyapatite column (1 · 10 cm) containing immobilized GPAO and catalase After GPAO (10 mkat) and catalase (10 mkat) ... shows a mass spectrum of the GPAO/DAPY reaction mixture prepared in 0.1 M ammonium bicarbonate containing ACA as a reagent for trapping of the product aminoaldehyde, where several new peaks appeared...

Ngày tải lên: 19/02/2014, 16:20

13 604 0
Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

... nitrogen concentration of 40 mM and the cell growth was inhibited at a high initial nitrogen concentration of 80 mM Similarly, the accumulation of total saponin and polysaccharide were also influenced ... culture maintenance [6] But use of this suspected carcinogen often create health and safety concerns Alterations in the environmental factors such as nutrient levels, light, and temperature may also ... The maximum biomass yield of cell suspension culture of ginseng was obtained in medium containing 2,4-D as compared to IBA or NAA However, ginsenoside production was much higher in IBA or NAA containing...

Ngày tải lên: 14/03/2014, 10:20

6 493 0
Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc

Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc

... b-apo-8¢-carotenal b-apo-10¢-carotenal b-apo-12¢-carotenal b-apo-14¢-carotenal b-apo-15¢-carotenal (retinal) b-apo-15¢-carotenoic acid (retinoic acid) 3-OH-b-apo-8¢-carotenal 3-OH-b-apo-10¢-carotenal ... Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu K, Yoneyama K et al (2008) Inhibition of shoot branching by new terpenoid plant hormones Nature 455, ... (data not shown) as b-apo-13-carotenone (C18), b-apo-15¢carotenal (retinal, C20) and b-apo-14¢-carotenal (C22) This activity demonstrated that MtCCO mediates the symmetrical cleavage of b-carotene...

Ngày tải lên: 15/03/2014, 23:20

12 377 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component of the cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined ... Involvement of bacterial polysaccharides in plant pathogens Ann Rev Phytopathol 33, 173–197 31 Reuhs, B.L., Kim, J.S & Matthysse, A. G (1997) Attachment of Agrobacterium tumefaciens to carrot cells and Arabidopsis ... presence of Kdn might be characteristic of plant pathogenic streptomycete strains causing scab diseases of potatoes and root crops Further studies of the cell wall anionic polymers in the plant pathogenic...

Ngày tải lên: 17/03/2014, 10:20

6 561 0
Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

... Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-AlaAla-Ala-Ala (Myr–AGG1-3X6S), with position of each motif separately occupied by each of the 20 amino acids (Fig 3A) ... Met-Gly-Ala-Ala-Ala-Ala-Ala-AlaAla-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala was amplified by PCR with the primers AGG1 RV and 3A6 (A ⁄ S) FW (Table S3) and with pTA2–AGG1 as the template The ... Met-Gly-Xaa-Ala-Ala-Ala-Lys-Ala-AlaAla (Myr–AGG1-3X 6A7 K) or Met-Gly-Xaa-AlaAla-Ser-Lys-Ala-Ala-Ala (Myr–AGG1-3X6S7K) (B, C) Each of the 20 mRNAs corresponding to Myr–AGG1-3X 6A7 K or Myr–AGG13X6S7K was...

Ngày tải lên: 29/03/2014, 21:20

12 473 0
Báo cáo lâm nghiệp: " Soil and plant communities development and ecological effectiveness of reclamation on a sand mine cast" ppt

Báo cáo lâm nghiệp: " Soil and plant communities development and ecological effectiveness of reclamation on a sand mine cast" ppt

... the area belongs to the Bytom Basin In general, its climate can be characterized by an annual average air temperature of 8°C and annual average precipitation of 700 mm The deposits are genetically ... Shannon diversity index 'H' and abundance of species (number of species) in plant communities depending on the age and category of areas in the Szczakowa sand mine cast Age of areas (years) Shannon ... mine-cast (South Poland) 15 10 5R 17 R 20 R 25 R 5S 17 S Age of areas (years)and category: Age of area (years) and category R – reclamation S – succession were reported in non-reclaimed areas A reported...

Ngày tải lên: 07/08/2014, 10:22

12 411 0
Báo cáo lâm nghiệp: "Effect of plant age, temperature and rainfall on Lepidoptera insect pests collected with light traps in a Eucalyptus grandis plantation in Brazil" docx

Báo cáo lâm nghiệp: "Effect of plant age, temperature and rainfall on Lepidoptera insect pests collected with light traps in a Eucalyptus grandis plantation in Brazil" docx

... programs in areas such as Tres Marias, Montes Claros, Ipatinga, Guanhães and Paraopeba (State of Minas Gerais), São José dos Campos, Caçapava, Guararema and Jambeiro (State of São Paulo) and Aracruz ... number of individuals of Glena unipennaria, Sabulodes caberata and Stenalcidia grosica (Geometridae) and temperature (°C) and rainfall (mm) in a Eucalyptus grandis plantation in the Municipality ... individuals collected per light trap for Stenalcidia grosica (A) , Glena unipennaria (B) and Sabulodes caberata (C) in a Eucalyptus grandis plantation in the Municipality of Nova Era, State of Minas...

Ngày tải lên: 08/08/2014, 00:21

6 302 0
Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx

Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx

... semi-arid tropical Africa [8, 9, 17] The Acacia species remain very abundant in savannas and arid regions of Australia, Africa, India and the Americas They generally are dependent on mycorrhizae ... vegetable crops in tropical areas Therefore, Acacia species may increase the occurrence and abundance of root knot nematodes in agroforestry systems and decrease the potential benefits (for plantation ... tree plantations Sporocarps were brushed free of adhering soil and fractured carefully in a laminar flow hood A small amount of tissue was then removed with a fine forceps and placed on MNM agar...

Ngày tải lên: 08/08/2014, 14:22

6 348 0
A biophysical elucidation for less toxicity of Agglutinin than Abrin-a from the Seeds of Abrus Precatorius in consequence of crystal structure pot

A biophysical elucidation for less toxicity of Agglutinin than Abrin-a from the Seeds of Abrus Precatorius in consequence of crystal structure pot

... molecule The α-carbon backbone of abrin -a AB-chains are superimposed on that of the AAG molecule using least-squares analysis A P41212 asymmetric unit of AAG contains an AB-chain and a CD-chain Disulphide ... Site comparison of abrin -a (red) and γ3 respectively Active site residues are drawn in red (b) Active Site comparison of abrin -a (red) AAG A- chain (black) AAG A- chain (black) and AAG C-chain (blue) ... reassociation with abrina B chain by site-directed mutagenesis Protein Engineering 1997, 10:827-833 25 Bagaria A, Surendranath K, Ramagopal UA, Ramakumar S, Karande AA: Structure-Function Analysis and...

Ngày tải lên: 10/08/2014, 05:21

13 259 0
báo cáo khoa học: " Transcriptomics and molecular evolutionary rate analysis of the bladderwort (Utricularia), a carnivorous plant with a minimal genome" pptx

báo cáo khoa học: " Transcriptomics and molecular evolutionary rate analysis of the bladderwort (Utricularia), a carnivorous plant with a minimal genome" pptx

... gibba mitochondrial region used in phylogenetic analysis (A) Mitochondrial genome comparison of Arabidopsis thaliana, Brassica napus, Carica papaya, Nicotianan tabacum and Vitis vinifera and ... database Additional file 9: Figure S2 - Validation of PEGs by qRT-PCR Expression patterns of APETALA1, APETALA3, PISTILLATA, AGAMOUS, SEPALATA3, CLAVATA1, MYB21, MYB24, RBCS-1B, SBPase, a- glucosidase, ... performed assembling, annotation, database construction, statistical analysis and manuscript writing VAA contributed to data analysis, phylogenetic analysis, drafting and editing of the manuscript CAPT...

Ngày tải lên: 11/08/2014, 11:21

16 434 0
báo cáo khoa học: "MeRy-B: a web knowledgebase for the storage, visualization, analysis and annotation of plant NMR metabolomic profiles" potx

báo cáo khoa học: "MeRy-B: a web knowledgebase for the storage, visualization, analysis and annotation of plant NMR metabolomic profiles" potx

... files and made available for consultation For example, all protocols are Page of 12 collected in PDF format files, as such files are already available as part of the quality assurance approach ... A, Saga H, Oikawa A, Shinbo Y, Kai K, Sakurai N, Suzuki H, Kitayama M, Shibata D, Kanaya S, Ohta D: Differential metabolomics unraveling light/dark regulation of metabolic activities in Arabidopsis ... experiments The preparation of analytical samples (plant extracts or plant fluids, such as sap or exudate), parameters of analytical instruments and spectrum processing metadata are described in...

Ngày tải lên: 11/08/2014, 11:21

12 368 0
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx

báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx

... plants Plant Cell 2005, 17(3):836-848 11 Kawabe A, Matsunaga S, Nakagawa K, Kurihara D, Yoneda A, Hasezawa S, Uchiyama S, Fukui K: Characterization of plant Aurora kinases during mitosis Plant Mol ... cDNA collection Science 2002, 296(5565):141-145 44 Kurihara D, Kawabe A, Matsunaga S, Nakagawa K, Fujimoto S, Uchiyama S, Fukui K: Characterization of a splicing variant of plant Aurora kinase Plant ... http://www.biomedcentral.com/1471-2229/11/73 Page 14 of 14 43 Seki M, Narusaka M, Kamiya A, Ishida J, Satou M, Sakurai T, Nakajima M, Enju A, Akiyama K, Oono Y, et al: Functional annotation of a full-length Arabidopsis...

Ngày tải lên: 11/08/2014, 11:22

14 333 0
Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps

Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps

... 5'ATGAGCTCATGGCAAGTAAAGGAGAAGAAC-3', and Reverse: 5'-CGGGATCCGAGCTCTTAGAGTTCGTCGTGTTTG-3' The amplified fragment was cloned in the forward orientation in VA/pCAMBIA1391Z, as obtained above, at SacI ... viral amplicon was found to be generated and replicated in plants like tomato, tobacco (Nicotiana xanthii), Arabidopsis thaliana and rice (Oryza sativa, variety Pusa Basmati) We also show that ... VA(AC2MAC4M)] of VA/ToLCV constructs in tomato plants (A) Total DNA was isolated from the tomato leaves agroinfiltrated with VIGS, VA(AC2M), VA(AC4M) and VA(AC2MAC4M) separately and the release of episome...

Ngày tải lên: 12/08/2014, 04:20

13 428 0
Báo cáo khoa học: " A novel virus that infecting hypovirulent strain XG36-1 of plant fungal pathogen Sclerotinia sclerotiorum" pptx

Báo cáo khoa học: " A novel virus that infecting hypovirulent strain XG36-1 of plant fungal pathogen Sclerotinia sclerotiorum" pptx

... strain Ep-1PN was originally isolated from diseased eggplant [21] All strains and their derivatives were grown on PDA (potato dextrose agar, PDA) at 20°C, and stored on PDA slants at 4–6°C Comparison ... 78:892-898 Sasaki A, Kanematsu S, Onoue M, Oikawa Y, Nakamura H, Yoshida K: Artificial infection of Rosellinia necatrix with purified viral particles of a member of the genus Mycoreovirus reveals its ... the experiments were analyzed using an analysis of variance (ANOVA) in SAS (SAS Software, NJ) Treatment means were compared with the test of least significant difference (LSD) at the p = 0.05 Competing...

Ngày tải lên: 12/08/2014, 04:21

9 293 0
w