lesions predominant leaflet tethering and regurgitation

Báo cáo khoa học: "Lesions in the thymus and bone marrow in chicks with experimentally induced chicken infectious anemia disease" pot

Ngày tải lên : 07/08/2014, 20:23

... Animal Science and Health (ID-DLO; Netherlands), and was used for the streptavidin-biotin peroxidase technique The antibody was intended for use at Table Sacrifice and sampling dates and number of ... experimental birds, and some of the destructive areas were observed to be replaced by reticular cells Those lesions seemed to progress, develop and were more significant and diffuse between days and 10 It ... 󰠏 󰠏 󰠏 18 Burak Kuscu et al Table ELISA test results and scoring of histopathologic lesions and immunoperoxidase results in the bone marrow and thymus Days Bird No ELISA test results C1 C2 C3...

9
333
0

Genetic polymorphisms of matrix metalloproteinases and their inhibitors in potentially malignant and malignant lesions of the head and neck potx

Ngày tải lên : 10/08/2014, 05:21

... Regulation of MMPs in potentially malignant and malignant head and neck lesions Polymorphism of MMPs in potentially malignant and malignant head and neck lesions The MMPs are regulated at many levels ... reported and that may influence gene transcription and expression level in potentially malignant and malignant lesions MMP-2 SNP is located at 1306 upstream of the transcriptional site and contains ... level and possess 12 conserved cysteine residues required for the formation of six loops Polymorphism of TIMPs in potentially malignant and malignant head and neck lesions O-Charoenrat and Khantapura...

13
337
0

Báo cáo khoa học: " The impact of elbow and knee joint lesions on abnormal gait and posture of sows" pptx

Ngày tải lên : 12/08/2014, 18:22

... the study and developed the gait and posture scoring methods RKK examined and scored the joint lesions with assistance from HEJ RKK and BJ performed the statistical analysis and RKK, BJ, and HEJ ... lesions and defined gait and posture variables in sows Methods Animals and housing An observational prospective study was carried out in a Danish pig herd Sixty randomly selected crossbred Landrace-Yorkshire ... variables of the gait and posture, of which buck-kneed forelegs, fore and hind legs turned out, and stiff in front and rear have been shown to be associated with osteochondrosis and arthrosis [9],...

8
243
0

Báo cáo y học: "Identification of clinical and simple laboratory variables predicting responsible gastrointestinal lesions in patients with iron deficiency anemia"

Ngày tải lên : 25/10/2012, 11:18

... endoscopic and radiographic Asymptomatic colonic and gastric carcinoma may present with IDA and exclusion of these conditions is of prime concern The upper endoscopic evaluation should include random ... diagnostic yield of endoscopy in patients with IDA and to define predictive factors of gastrointestinal (GI) lesions causing IDA and identify clinical and biochemical variables that predict the outcome ... incidence of GI pathological findings in symptomatic and asymptomatic patients with IDA and to identify the predictive factors for such lesions Patients and Methods From March 2006 to July 2007, 91 patients...

9
425
1

Oral Cancer and Precancerous Lesions pot

Ngày tải lên : 15/03/2014, 01:20

... palpate lymph nodes and salivary glands Lips • Inspect and palpate outer surfaces of lip and vermilion border • Inspect and palpate inner labial mucosa Buccal mucosa • Inspect and palpate inner ... nut and slaked lime, usually with tobacco and sometimes with sweeteners and condiments The slaked lime results in the Volume 52 • Number • July/August 2002 197 Oral Cancer and Precancerous Lesions ... maxillary/mandibular gingiva and alveolar ridges on both the buccal and lingual aspects Tongue • Have patient protrude tongue and inspect the dorsal surface • Have patient lift tongue and inspect...

21
276
0

Oral Cancer and Precancerous Lesions doc

Ngày tải lên : 15/03/2014, 01:20

... 145 000 cases and 56 000 deaths in the European Union in 1998 Rates of incidence vary considerably among countries (Table 1), and appear to be increasing because of more frequent and better diagnostic ... indispensable Adequacy is determined both by proven medical effect and ethical and legal acceptability Screening followed by diagnosis and intervention in an early stage of the disease should provide ... programme, burden of disease Table Incidence and death rates from prostate cancer by country in 1998 Population Cases Age-standardized rate Deaths Age-standardized rate (per 100 000) (per 100 000)...

12
245
0

Báo cáo khoa học: The predominant protein arginine methyltransferase PRMT1 is critical for zebrafish convergence and extension during gastrulation pdf

Ngày tải lên : 28/03/2014, 23:20

... PRMT1 expression and function during embryogenesis Fig Genomic structure and partial nucleotide and amino acid sequences of the zebraﬁsh prmt1 gene (A) Genomic structure of human and zebraﬁsh prmt1 ... diminished at the end of one side, and extended and compressed at the other The width was greatly broadened and the lateral myoD expression was greatly expanded in type morphants Even though ... precursors of the mesoderm and endoderm, and C ⁄ E, in which cells accumulate on the dorsal side and lead to axis formation Gastrulation begins at 50% of epiboly (6 hpf) and ends at 100% (10 hpf)...

13
368
0

Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf

Ngày tải lên : 30/03/2014, 11:20

... serum and phenol red were washed with NaCl ⁄ Pi, and the DMEM without fetal calf serum and phenol red was added (2 mL per 60-mm dish) followed by the addition of CSE (2% ﬁnal concentration) and ... using two different dilutions (1 : and : 729) of template cDNA from the control clone (lanes and 3) and the same dilutions of cDNA from the KD-1 clone (lanes and 4) Control reactions with b-actin ... targeting PRDX5 cDNA (exons and underlined) were: TTTGAGA ACCTCTTGAGACGTCGATGACGTCTCAAGAGGTTC TCTTTTT (top strand) and CTAGAAAAAGAGAA CCTCTTGAGACGTCATCGACGTCTCAAGAGGTTCT (bottom strand) Targeted segments...

11
463
0

báo cáo hóa học:" Human immunodeficiency virus and human papilloma virus - why HPV-induced lesions do not spontaneously resolve and why therapeutic vaccination can be successful" pot

Ngày tải lên : 18/06/2014, 15:20

... persistence of HPV and HPV-induced lesions indicate that HPV-infection was not counteracted in the first place and that the virus was allowed to establish LSIL and/ or HSIL lesions before the ... HIV[41] and while HIVinduced immunosuppression can be held accountable for the increased incidence of precursor lesions it does not explain why these lesions not resolve when HAART is given and immunosuppression ... infections and the detection of T-cell responses against agents such as CMV [35], Candida, Mycobacterium and Streptococcus [36,37] This occurs a few months after therapy has commenced and is thought...

8
634
0

báo cáo hóa học: " Production of IL-16 correlates with CD4+ Th1 inflammation and phosphorylation of axonal cytoskeleton in multiple sclerosis lesions" pptx

Ngày tải lên : 19/06/2014, 22:20

... expression and distinct regulation of pro- and secreted IL-16 in acute, subacute and chronic MS lesions, and in normal-appearing white matter, from brain and spinal cord of 39 patients with MS and 19 ... infiltration also decreased from acute to subacute and chronic lesions [5] In brain lesions, levels of T-bet were almost equally high in acute and chronic lesions, and corresponded to similarly high levels ... measured in acute lesions (AL), which then subsided in subacute lesions (SAL) and chronic lesions (CL) Levels of active caspase-3 were markedly and persistently higher in MS lesions compared to...

13
425
0

Báo cáo hóa học: " High level expression of human epithelial β-defensins (hBD-1, 2 and 3) in papillomavirus induced lesions" ppt

Ngày tải lên : 20/06/2014, 01:20

... normal airway and oral epithelium and are believed to be key mediators of innate mucosal defense system [11-15] For example, both constitutively expressed hBD-1 and induced hBD-2 and hBD-3 have ... variety of bacterial and fungal pathogens [16,17], and more recently, shown to inactivate both enveloped and nonenveloped viruses including human immunodeficiency virus type (HIV-1) and adenovirus ... intestinal and genital tract epithelia [9] Human β-defensins (hBDs) including hBD-1, hBD-2, and hBD-3 are widely expressed in epithelial cells [9,10] These are detectable in most cutaneous and mucosal...

8
439
0

báo cáo khoa học: "Odontogenic tumors and giant cell lesions of jaws - a nine year study" docx

Ngày tải lên : 09/08/2014, 02:20

... similar incidence of these lesions in both adults and children and mandible was the commonest jaw bone involved [11,12] Most of these jaw lesions present with swelling, pain and ulceration [10] In ... both males aged 10 and 27 years One presented with the lesion in mandible and the other in the maxilla Radiologically, most of these lesions initially present as unilocular lesions which eventually ... Lurie AG: Cysts and cystic lesions of the Mandible-Clinical, Radiologic and Histopathologic Review Radiographics 1999, 19:1107-1124 Goaz PW, White SC: Oral radiology: principles and interpretation...

8
275
0

Báo cáo khoa học: "Incidental thyroid lesions detected by FDG-PET/CT: prevalence and risk of thyroid cancer" ppsx

Ngày tải lên : 09/08/2014, 04:21

... thyroid nodules and demonstrated that the sensitivity and specificity of FDG-PET/CT were 60% and 91% The positive predictive value and negative predictive value of the FDG-PET/ CT was 75% and 83% Jeong ... drafted the manuscript and contributed to conception and design BJC contributed to acquisition and analysis of data WCP, JSK and SSJ participated in the design of the study and revised ir critically ... benign lesions and malignant lesions (P < 0.001) Page of (page number not for citation purposes) SUVmax World Journal of Surgical Oncology 2009, 7:63 Size of cancer (mm) Figure between SUVmax and...

7
307
0

Báo cáo y học: "Familial, structural, and environmental correlates of MRI-defined bone marrow lesions: a sibpair study" pot

Ngày tải lên : 09/08/2014, 08:22

... prevalence of grade bone marrow lesions was 6% and 10% for lateral and medial compartments, respectively, and accounted for 40% of the total prevalence Medial bone marrow lesions were more common in ... contributions GJ, GZ and FC were responsible for the study design and interpretation of the results CD and GZ performed data collection GZ, JS and GJ conducted the statistical analysis GZ and GJ prepared ... or more) and the total score (0 to 8) for lateral and medial compartments, respectively X-rays A standing AP semiflexed view of the right knee was performed in all subjects at baseline and assessed...

6
378
0

Báo cáo y học: "Biochemical markers of bone turnover and their association with bone marrow lesions" docx

Ngày tải lên : 09/08/2014, 13:21

... participated in data analysis and interpretation, and manuscript preparation, and approved the final manuscript DCB participated in study design and manuscript preparation, and approved the final manuscript ... sex, and BMI was 1.06 (0.76 to 1.48) On investigation of the relation between biomarkers and semiquantitative BML, we did not find a significant relationship between BSAP and osteocalcin and BML ... with large joint OA and hand OA, suggesting an increased rate of bone turnover [34] Recently, Garnero and colleagues [36] examined the relation between bone marrow abnormalities and CTX-II – a type...

8
354
0

Báo cáo y học: "Clinical and neuropathological study about the neurotization of the suprascapular nerve in obstetric brachial plexus lesions" potx

Ngày tải lên : 10/08/2014, 10:20

... Different parameters were measured: active and passive external rotation in adduction and in abduction as well as a part of the Mallet score (hand to mouth and hand to head, see Table 1) to assess the ... closed, and a handmade well-padded head and neck plaster was used, which was worn for a period of weeks Clinical examination methods We studied the recovery of the active external rotation and the ... motion, assessing the presence of contractures and the articular mobility We stabilized the scapulothoracic joint with one hand and used the other hand to assess the glenohumeral joint external...

11
399
0

Báo cáo y học: "Mitral valve surgery for mitral regurgitation caused by Libman-Sacks endocarditis: a report of four cases and a systematic review of the literature" pptx

Ngày tải lên : 10/08/2014, 10:20

... Chile such as stroke and transient ischaemic attacks, and severe valvular regurgitation and/ or stenosis requiring surgery The literature on mitral valve surgery for mitral regurgitation (MR) caused ... vary in size and typically have a wart-like morphology They can be found near the edge of the leaflets along the line of closure; both on the atrial and ventricular sides of the leaflets They ... Transthoracic (TTE) and transesophageal echocardiography (TEE) revealed severe MR with thickened mitral valve leaflets and a small vegetation on the posterior mitral valve leaflet Repeated blood...

13
584
0

Báo cáo y học: "Distribution and correlates of plantar hyperkeratotic lesions in older peo" ppt

Ngày tải lên : 10/08/2014, 21:23

... hyperkeratotic lesions in a large sample of older people and to explore associations between the presence of lesions and physical characteristics (gender, obesity and dominant foot) and foot characteristics ... Plantar lesions are frequently painful and are associated with reduced walking speed, impaired balance and difficulty in ascending and descending stairs [5], resulting in disability and reduced ... Associations and comparisons between participants with and without hyperkeratotic lesions were determined using the chisquare statistic and odds ratios (for dichotomous variables) and independent...

7
349
0

báo cáo khoa học: "Giant right coronary artery aneurysm presenting with non-ST elevation myocardial infarction and severe mitral regurgitation: a case report" ppsx

Ngày tải lên : 10/08/2014, 23:20

... enlargement and severe mitral regurgitation (Figure 2) The mechanism of the mitral regurgitation was secondary to ischemia from the acute MI Although the mitral valve leaflets and subvalvular apparatus ... symptomatology and morbidity and thus its diagnosis and subsequent management Chest pain, angina, MI, heart failure, the presence of a mediastinal mass, superior vena cava obstruction and even hemoptysis ... valve leaflet, and no new regional wall motion abnormalities in the lateral wall or inferoposterior regions to suggest a circumflex artery injury following repair Following re-establishment and...

4
113
0

Báo cáo y học: "A female survivor of childhood medulloblastoma presenting with growth-hormone-induced edema and inflammatory lesions: a case report" doc

Ngày tải lên : 11/08/2014, 19:21

... necrotic and treatment-related nature These lesions had increased in number in the MRI of December 2001, and they appeared more strongly gadoliniumenhanced in subsequent images in February and April ... the right hemisphere and in contact with the basal nuclei and the thalamus There was no evidence of recurrent disease in the posterior fossa The girl also reported headache and visual impairment ... endocrinologist assessed the girl At years and MRI: INCREASE OF PERIFOCAL EDEMA OCCUPYING THE POSTERIOR HALF OF THE RIGHT HEMISPHERE AND IN CONTACT WITH THE BASAL NUCLEI AND THALAMUS NO CLINICAL AMELIORATION...

5
220
0