length of each element in a vector r
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers. The possible expla-nations may be: (1) some rare cancer death rates are ... is also associated with both smok-ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy-sis ... which had low rates, the discrepancies in CIs were increased because of a large standard error, and this was particularly true for rural residents. The relative risks for cancer deaths between...
- 9
- 532
- 1
Binding a Group of Radio Buttons in a Windows Form
... all records from table TBL0709 in the sample database and to update changes made back to the database. The DataAdapter is used to fill a DataTable in a new DataSet with the schema and data ... simple-bind to data, there is no way to bind a group of RadioButton controls to a data source. Binding a single radio button to a data source isn't a particularly common requirement—nor is ... binding manager base for the table. [ Team LiB ] Recipe 7.9 Binding a Group of Radio Buttons in a Windows Form Problem You need to bind a field in a database to a radio button and update...
- 6
- 583
- 0
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc
... decompose a surface with quadatric curvaturedecay into disjoint almost stable subdomains and a “remainder” with quadraticarea growth.For applications of the results of this part in [CM5], ... their boundary. in R 3(and not that the interior boundary has small length) . This distinctionis important; in particular if one had a bound for the area of a tubular neigh-borhood of the interior ... curves and surfaces withextrinsic balls. We will always assume that these intersections are transversesince this can be achieved by an arbitrarily small perturbation of the radius. 542 TOBIAS...
- 51
- 463
- 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt
... something of a global lingua franca, many languages are cur-rently undergoing a process of introducing new loan-words borrowed from English. However, while themotivations for borrowing are well ... train a maximum entropy classi-fier, using character 1- through 6-grams (includingword boundaries) as features. Since we could notmanually annotate a large portion of the MZEE cor-pus, the training ... the dynamics of thisprocess are poorly understood. While mainstreampolitical debates often frame borrowing as evidence of cultural or linguistic decline, it is particularly per-vasive in youth...
- 5
- 537
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... Model-theoretic semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. ... "An interpretation system for Montague grammar", American Journal for Computational Linguistics, microfiche 74, 23-96. Friedman, J., D. Moran, and D. Warren (1979) "Dynamic interpretations", ... Dynamic models are incomplete models that include only the information needed for an application and to which information can be added. Dynamic models are basically approximations of larger...
- 3
- 394
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx
... for apartheid: after all, in holding racist views, he was in the mainstream of politics. Rather, he strongly favoured a unitary system of government over a federal one for South Africa because ... Africa, he was a member of the Imperial War Cabinet duringthe First World War, played a significant role in the foundation of the League of Nations,and was made Chancellor of the University of ... situationsrequires a departure from the rule -of- law regime appropriate for ordinarytimes and so whatever role one accords to judges in ordinary times has tobe significantly rethought. And often...
- 268
- 661
- 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency docx
... international legal order, not just about the values inherent in the law of a particular legal order orfamilyof legal orders. Moreover, Iwantto claim that only by understanding the rule of law and ... looksmainly to cases decided in the United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule -of- law project capable of responding to situations ... are drawn are theUnited Kingdom, Canada, and Australia. Together they present a fertileground for testing my claims because, until quite recently, Canada andAustralia had what I will refer...
- 268
- 1,134
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... vacuolar-membrane-enriched fractions of the transformants of AACEVAPD1 –6. Thevacuolar-membrane-enriched fractions were prepared as described in Materials and methods. Samples of the membrane ... prb1D1. 6R, can1, GAL] [10]. The YN11 strain was derived fromYPH499 strain, and YN45 strain was prepared by the use of YN11 and BJ5458 strains.Preparation of AACEVAPD1 –650RACE and 30RACE ... without any misreading wasinnoculated in 30 mL of Luria –Bertani/ampicillin mediumand the plasmid DNA was purified over a Qiagen-Tip100column.Conversion of TAA to CAA and preparation of recombinants...
- 8
- 391
- 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc
... genus in a fixed (but arbitrary) closedRiemannian 3-manifold. The key for understanding such surfaces is to un-derstand the local structure in a ball and in particular the structure of anembedded ... graph near 0. Figure 6: Theorem 0.4— finding a small multi-valued graph in a disk near a point of large curvature.Theorem 0.3 is particularly useful when combined with a result from [CM4]asserting ... function or is a doublespiral staircase where each staircase is a multi-valued graph. This will be doneby showing that if the curvature is large at some point (and hence the surfaceis not a graph),...
- 43
- 410
- 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx
... number and have reached as high as 32% from reports from tertiary referral hospitals.3 ( ) Add two drugs to current regimen and reevaluate ( ) Refer to an Infectious disease Specialist for consult ... Luke’s realize the magnitude of TB problem in the country. However, the majority does not favorably rate the National TB Program and DOT. The lack of awareness that TB is reportable and the paperwork ... forms in the offices of our private practitioners, the lack of information on the health authority to contact and not just the paperwork that it entails may have contributed to a certain degree...
- 10
- 517
- 1
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCCT3 AATTAACCCTCACTAAAGGGB1 GCCGGGATCCTAGGGCGAATTGGGTACC864 ... Taq DNA polymerase were pur-chased from Takara Shuzo (Japan). The mCAP RNAcapping kit and proteinase K were from Stratagene. RNasewas purchased from Boehringer-Mannheim (Germany).Rabbit reticulocyte ... Yoshiyuki Kayano, Sayaka Nakao, Nagisa Sakurai,Hiroyuki Iwata1and Rumi IshisakaDepartment of Biological Chemistry and1Department of Veterinary Medicine, Faculty of Agriculture, Yamaguchi University,Yamaguchi,...
- 12
- 512
- 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx
... theresults of our parameter scanning, where only 12.5% of systems with increased HXT(Vmax) reach steady-state.Those systems with increased HXT limiting rate that areable to reach steady-state ... branchingsteps are significantly correlated with each other, thiscorrelation is always positive, and where FCCs for themain-chain of glycolysis (HK-ADH) are correlated with each other, these, too are also ... role for hexokinase and the remainder of main-chain glycolysis having only minimal relevance. This patternhas previously been observed in a study of glycolytic fluxcontrol in rat heart perfused...
- 11
- 530
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose