... sets and common parameters 26 Optional and mandatory parameters 27 Positional parameters 28 Parameter values 30 Finding command examples 32 ■ ■ ■ 3. 6 3. 7 3. 8 Accessing “about” topics 32 Accessing ... Getting PowerShell to the hard work 270 Making parameters mandatory 271 Adding parameter aliases 2 73 Validating parameter input 274 Adding the warm and fuzzies with verbose output Lab 277 Advanced ... www.manning.com/ LearnWindowsPowerShell3inaMonthofLunchesSecondEdition That said, there are a few conventions that you should be aware of Code will always appear in a special font, just like this example:...
Ngày tải lên: 05/05/2014, 14:44
... to India via Danubian culture, a new stage of development beginning with the Age of Metals’ He points out that there are marked similarities between the ideas of regions as far apart as America, ... function alone is modified and inverted, for, instead of indicating metaphysical and spiritual principles—instead of possessing an emotional content—they are artificial creations designating physical ... suggestions, keeping, as always in this work, within the limits of comparative analysis For the Hindu philosopher Ananda K Coomaraswamy, symbolism is ‘the art of thinking in images’, an art now lost...
Ngày tải lên: 12/03/2014, 18:09
The Book of JavaScript, 2nd Edition pdf
... advancements in JavaScript, most notably the advent of Ajax Ajax is a concept that makes even a few professional programmers’ heads spin, but (not surprisingly) Dave manages to break down what Ajax is and ... other kinds of information Syntax of Variables The syntax of variables (the set of rules for defining and using variables) is slightly different in JavaScript from what it was in your algebra class ... fax: 415.8 63. 9950; info@nostarch.com; www.nostarch.com Library of Congress Cataloging -in- Publication Data Thau The book of JavaScript : a practical guide to interactive Web pages / Thau! 2nd...
Ngày tải lên: 17/03/2014, 12:20
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot
... antibody against BNIP3 was first incubated with a BNIP3–GST protein (F) Quantification of the western blot bands revealed a nine-fold increase of BNIP3 in KA-injected striatum There was a 3. 5-fold increase ... expression of BNIP3 after KA BNIP3 in excitotoxicity administration was caused by activation of kainate receptors, brain tissue was processed from rats that received intrastriatal injections (1 lL) of ... protein A nonspecific 62 kDa band was detected in all of the striatal samples Quantification of the bands with the b-actin bands as internal controls revealed that injection of KA upregulated BNIP3...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo y học: " Dietary intake of fish, omega-3, omega-6 polyunsaturated fatty acids and vitamin D and the prevalence of psychotic-like symptoms in a cohort of 33 000 women from the general population" ppt
... importance A high intake ratio of omega -3: omega-6 fatty acids favor omega -3 fatty acid metabolism For example, high intake of omega -3 fatty acids partly replaces omega-6 fatty acids incorporation into ... summarized the intake of α-linolenic, EPA, DHA and docosapentaenoic acids (DPA) We combined EPA, DHA and DPA to estimate the total intake of marine fatty acids To estimate the total intake of ... docosapentaenoic acid d Adjusted for age, total energy intake and dietary intake of vitamin B12, alcohol and dietary intake of fat other than eicosapentaenoic acid, docosahexaenoic acid and docosapentaenoic...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... 16 Minamitani M, Tanaka J, Hasumura M, et al Cerebral malformations associated with probable intrauterine infection No To Hattatsu 19 93; 25: 35 9- 63 17 Singleton WG, Lawrence T, Green AL, et al ... management approaches, he was managed conservatively and was healthy on a follow-up Figure Neuroimaging of the twins (a) Cerebral CT of twin A shows a vast lesion of cerebrospinal fluid intensity in ... head surgery17 In our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are...
Ngày tải lên: 25/10/2012, 11:00
Tài liệu Microsoft Windows PowerShell 3.0 Firstlook pdf
... demonstrate an edge case of some theorem was far more satisfying So after attaining a Masters degree in mathematics he entered the field of software testing and reliability and hasn't looked back ... Morris Shay Levy Indexers David Karapetyan Hemangini Bari Tejal Daruwale Acquisition Editor Dhwani Devater Graphics Lead Technical Editor Manu Joseph Susmita Panda Production Coordinator Technical ... that you are running Windows 7, Windows Server 2008, or Windows Server 2008 R2 The final chapter in this book requires an installation of Windows or Windows Server 2012 There are chapters within...
Ngày tải lên: 17/02/2014, 23:20
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... to be invariable as all the enzymes analyzed so far have a a3b3 (F1F0) or A3 B3 (A1 A0, V1V0) stoichiometry [28] The uncertainty lay in the number of ion-translocating subunits in the membrane-embedded ... reference-free averages generated by translational and rotational alignment of single c rings showed the same stoichiometry (Fig 2D,E) From both the raw data and averages of c rings, it was clear that they ... c ring of A woodii has only 10 membrane-buried negative charges that are essential for binding the ion and also for the rotational mechanism of the ring The c ring of I tartaricus has 11 negative...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Design, Lifestyles and Sustainability. Aesthetic Consumption in a World of Abundance pptx
... more becoming a matter of practice: eating at particular restaurants, staying at particular hotels or choosing particular means of transportation Cultural capital, in Holt’s interpretation, is ... Contemporary Studies of Sustainable Consumption A vast number of articles focusing on sustainable consumption have appeared in sustainability-oriented academic journals since the beginning of the ... Dordrecht; 133 –141 Bentley M 20 03 Sustainable Consumption Ethics, National Indices and International Relations American Graduate School of International Relations and Diplomacy: Paris Böhme G 20 03 Contribution...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... whether a small amount of a- L-1 ,3- arabinofuranosidase was responsible for the disappearance of Fig HPAEC analysis of the hydrolysis of arabinogalactans by GALA Three different arabinogalactans were ... 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and 38 % L-arabinose Methylation analysis demonstrated that a substantial amount of the L-arabinose residues ... Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Executive coaching: Developing managerial wisdom in a world of chaos doc
... Conflict Faced by Executives Avoidanceavoidance Approachavoidance External adaptation Multiple approachavoidance Approachapproach Avoidance avoidance Approachavoidance Internal adaptation Multiple approachavoidance ... lntraindividual Individual Group Organizational unit lntraorganizational Whole organizational lnterorganizational LocaI Regional National International Global ’Kuhn, A (1 974) The Logic of Social ... individuals, dyads, or groups to learn about and change behaviors influenced by the shadow side The best training and experience available can be obtained in programs preparing mental health professionals...
Ngày tải lên: 21/02/2014, 16:20
Tài liệu Báo cáo khoa học: "MACHINE-READABLE COMPONENTS IN A VARIETY OF INFORMATION-SYSTEM APPLICATIONS" potx
Ngày tải lên: 21/02/2014, 20:20
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG) -3 The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG) -3 and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA) -3 , lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG) -3 ; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was further reinforced...
Ngày tải lên: 22/02/2014, 04:20
Subjective memory complaints and cognitive performance in a sample of healthy elderly pot
... utilization of the mini-mental state examination in Brazil Arq Neuropsiquiatr 20 03; 61:777-781 Alexopoulos GS, Abrams RC, Young RC, Shamoian CA Use of the Cornell scale in nondemented patients J Am ... complaint in age-associated memory impairment: the MACQ Int Psychogeriatr 1992;4:165-176 18 Mattos P, Lino V, Rizo L, Alfano A, Araújo C, Raggio R Memory complaints and test performance in healthy ... individuals; MMSE: Mini-Mental State Examination; MAC-Q: Memory Complaint Questionnaire *Results represent mean values±standard deviation Table Comparison between the groups of complainers and non-complainers...
Ngày tải lên: 05/03/2014, 21:20
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx
... part of a more general task of escaping from an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are ... decided in the United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule -of- law project capable of responding to situations which place legal and ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent...
Ngày tải lên: 07/03/2014, 02:20
THE CONSTITUTION OF LAW Legality in a Time of Emergency docx
... part of a more general task of escaping from an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are ... decided in the United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule -of- law project capable of responding to situations which place legal and ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf
... L-Leucine availability regulates phosphatidylinositol 3- kinase, p70, S6 kinase and glycogen synthase kinase -3 activity in L6 muscle cells: evidence for the involvement of the mammalian target of rapamycin ... is also noteworthy that an analysis of the GS activity ratio in 3T3-L1 preadipocytes reveals that in unstimulated cells, basal GS activity was 80% lower than that measured in differentiated adipocytes ... (using Li or SB-415286) appears to be sufficient for inducing activation of GS in muscle and fat cells, and that inhibition of the kinase potentiates insulin action in muscle of insulin-resistant...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf
... conserved A subunit-binding domains (ASBD and ASBD 2) in human B5 6a, rat Ba, and human PR72, highlighted in gray information for further elucidating the structural basis of interactions in the PP 2A holoenzyme ... Fig Binding of the two conserved domains in Ba and PR72 to the A subunit of PP 2A Fragments of rat Ba and human PR72 encompassing ASBD and were tested for binding to GST and GST -A by incubation ... subunits in organisms as diverse as Neurospora crassa, Candida tropicalis, Dictyostelium discoideum, Medicago varia (alfalfa), Arabidopsis thaliana, Oryza sativa (rice), Caenorhabditis elegans, Drosophila...
Ngày tải lên: 08/03/2014, 10:20