learn c programming in tamil pdf
Tài liệu Practical C Programming Third Edition pdf
Ngày tải lên :
14/02/2014, 20:20
... generic cc compiler or the Free Software Foundation’s gcc
compiler. For MS-DOS/Windows users, instructions are included for Borland C+ +,
Turbo C+ +, and Microsoft Visual C+ +. (These compilers compile ... of many
chapters, you will find a section called Programming Exercises.” These sections
contain exercises that might be used in a programming class to test your knowl-
edge of C programming.
Notes ... entry for information on how to get their software.)
Among their offerings is a C compiler called gcc.
To compile a program using the gcc compiler use the following command line:
% gcc -g -Wall...
- 456
- 3K
- 7
David haskins c programming in linux
Ngày tải lên :
19/03/2014, 14:07
...
Introduction
The teaching approach
I began university teaching later in life after a career programming in the telecommunications industry.
My concern has been to convey the sheer fun and creativity ... array of pointers to character
strings called argv[].
Download free books at BookBooN.com
C Programming in Linux
8
Introduction
Introduction
Why learn the C language?
Because the C language ...
*****************************************************************/
#include <stdio.h>
int main(int argc, char *argv[])
{
printf("Hello, you are learning C! !\n");
return 0;
}
Download free books at BookBooN.com
C Programming in Linux
...
- 84
- 318
- 0
Learn C on the Mac pdf
Ngày tải lên :
24/03/2014, 00:21
... numerical constants (such as 237) directly
in your code. In the programming world, these are called literals.
Look at this example:
#include <stdio.h>
int main( int argc, const char ... scroll bars, and windows, you’ll need to
finish this book, then learn Objective -C and Cocoa (for the Mac) or Cocoa Touch
(for iOS devices).
Objective -C is a programming language based on C. ... menu. Cocoa is a vast collection of objects that
represent all the elements of the Mac experience. Objective -C was designed to
work together with Cocoa and Cocoa Touch.
Learn C, Objective -C, ...
- 502
- 3.8K
- 0
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
Ngày tải lên :
30/03/2014, 04:20
... following prim-
ers: 5Â-GCTTCAGCTGGGATCCGGTGGTATGGTGA G
CAAGG-3Â; and 5Â-CCAGATCGCGGCCGCTTAGTGG
TGATGATGGTGGTGATGATGCTTGTACAGCTCGT
CC-3Â. Following the His
8
-tag, a TAA stop codon was
inserted in ... primer,
5Â-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC
GAA-3Â; 2.5T sense primer, 5Â-GCGCAAGCGCTTACG
ACTTAAAAAAATTGGTCAGAAAATCCAGG-3Â; 2.5T
antisense primer, 5Â-CCTGGATTTTCTGACCAATTTTT
TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense ... primers
5Â-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG
GAGC-3Â and 5Â-CCAGATCGCGGCCGCCTTGTACAG
CTCGTCATGCCGAGAG-3Â; EcoRI and ApaI restriction
enzyme sites were introduced into the 5Â-end and 3Â-end of
the Cerulean DNA fragment....
- 16
- 329
- 0
A Complete Guide to Programming in C++ part 9 pdf
Ngày tải lên :
06/07/2014, 17:21
... minimum field width to n
Returns the fill character used
Sets the fill character to ch
int width() const;
int width(int n);
int fill() const;
int fill(int ch);
Manipulator Effects
Sets the minimum ... Declaration of cin, cout
#include <iomanip> // For manipulators being called
// with arguments.
#include <string>
using namespace std;
int main()
{
int number = ' ';
cout ... generates octal, decimal, and hexadecimal output.
#include <iostream> // Declarations of cin, cout and
using namespace std; // manipulators oct, hex,
int main()
{
int number;
cout <<...
- 10
- 615
- 1
A Complete Guide to Programming in C++ part 20 pdf
Ngày tải lên :
06/07/2014, 17:21
... left curved bracket indicates the start of a function block, which contains the state-
ments defining what the function does.
ᮀ Prototype and Definition
In a function definition the function ... settings for program com-
pilation.
DEFINING FUNCTIONS
■
175
The following section describes how to program global functions. Chapter 13, Defining
Classes, describes the steps for defining member ... of inheritance to create specialized classes without needing to
change any existing classes.
When implementing a class you must define the capacities of those objects, that is,
the member functions,...
- 10
- 517
- 0
A Complete Guide to Programming in C++ part 26 pdf
Ngày tải lên :
06/07/2014, 17:21
... manipulates a local copy.
Thus, only a local copy of the string is changed in the function, but the string in
the calling function remains unchanged.
Exercise 2
//
// circle.cpp
// Defines and calls the ... Defines and calls the function circle().
//
#include <iostream>
#include <iomanip>
#include <string>
using namespace std;
// Prototype of circle():
void circle( const double& ... function strToUpper() is
declared as a
string& instead of a string?
Exercise 2
Write a void type function called circle()to calculate the circumference and
area of a circle.The radius and two...
- 10
- 415
- 0
A Complete Guide to Programming in C++ part 27 pdf
Ngày tải lên :
06/07/2014, 17:21
... account.h
// Defining the class Account.
//
#ifndef _ACCOUNT_ // Avoid multiple inclusions.
#define _ACCOUNT_
#include <iostream>
#include <string>
using namespace std;
class Account
{
private: ... external access, and the public members of that class. An applica-
tion program accesses objects by using the public methods of the class and thus activat-
ing its capacities.
Access to object data ... following example includes a class named Account used to represent a bank
account. The data members, such as the name of the account holder, the account num-
ber, and the account balance, are declared...
- 10
- 375
- 0
A Complete Guide to Programming in C++ part 28 pdf
Ngày tải lên :
06/07/2014, 17:21
... defining the
methods for the class Account in a source file named Account.cpp, for example.
The source code of the application program, for example, the code containing the
function main, is independent ... If you place the definition of the class Account in the
file Account.h, any source file including the header file can use the class Account.
Methods must always be defined within a source file. ... ok
pAccount->init( name, nr, startcapital);
return true;
}
■
POINTERS TO OBJECTS
Sample program
252
■
CHAPTER 13 DEFINING CLASSES
// account_t.cpp
// Uses objects of class Account.
//
#include...
- 10
- 386
- 0
A Complete Guide to Programming in C++ part 45 pdf
Ngày tải lên :
06/07/2014, 17:21
... methods in this “friendly” class automatically become
friend functions in the class containing the friend declaration.
This technique is useful if a class is used in such close conjunction with ... to access the private data members of the class can dramatically
improve the function’s response.
ᮀ Declaring Friend Functions
A class can grant any function a special permit for direct access ... using dynamic memory allocation.
FRIEND CLASSES
■
425
ᮀ Declaring Friend Classes
In addition to declaring individual friend functions, you can also make entire classes
“friends” of another class....
- 10
- 281
- 0
