... Chinese and Russian Take French as an example, a recent survey of the Ministry of Education and Training reveals that the numbers of French teachers and learners have decreased sharply and continuously ... Luxembourg: Office for Official Publications of the European Communities, ISBN 978-92-79-06902-4 Chandra Shah & Michael Long (2007) Labour mobility and mutual recognition of skills and qualifications: ... one of the biggest problem is also language The Ministry of Education and Training of Vietnam estimates that at the present time, there are about 60,000 Vietnamese students abroad, and many of...
... Timber by System and Year Built – All States + DC and PR 19 Table A.10 – Number and Percent of Bridges with Main Span Material of RC, PS, Steel and Timber by System and Span Length ... All States + DC and PR 20 Table A.11 – Deck Area and Percent of Bridges with Main Span Material of RC, PS, Steel and Timber by System and Year Built – All States + DC and PR ... A.12 – Deck Area and Percent of Bridges with Main Span Material of RC, PS, Steel and Timber by System and Span Length – All States + DC and PR 22 Table A.13 – Percent of Structurally...
... meaningful only in terms of the incrementing of consumer appeal of the product, and it would be difficult to answer without research in that very area From the point of view of an MT research group, ... implementation of such an article insertion program as that discussed here is justified as a test of the program's inherent merits and also as a means of facilitating research into the question of consumer ... More obvious, of course, but of great importance, was another criterion: "Is the English noun token singular or plural?" To test the significance and power of these two criteria, and to gauge...
... speaking learning in particular and English speaking in general The subjects of questionnaires are comprised 80% of females and the rest of males and the age was between 19 and 20 These students have ... quickly from a large number of participants and is “one of the most common methods of collecting data on attitudes and opinions from a large group of participants” and it “allows researchers to ... difference between simulations and games is on the represented degree of reality of function unlike education simulations, games often involve elements of fantasy and make-believe whereas simulations...
... the amount and form of transcribing depends on factors such as nature of the materials and the purpose of the investigation, the time and money available, the availability of a reliable and patient ... CLC students during ten-week length of the module One of them deals with two lessons of Listening and Speaking and the other is in charge of teaching Reading and Writing skill It should be noted ... defined “…as a study of a large group through direct study of a subset of that group.”(Johnson D.M, 1992: 105) It is the 31 study of attitudes, beliefs, and behavior of people and their settings...
... imitation and language drills, and language was thought of as a compendium of rules and strings of words and sentences used to form propositions about a state of affairs In the last two decades, ... when the learner understands the perspectives of others and is offered the opportunity to reflect on his own perspectives, through a process of decentering and a level of reciprocity, there arises ... comply A corollary of this third perspective is to view the teaching of culture as a means of developing an awareness of, and sensitivity towards, the values and traditions of the people whose...
... Faculty of Management and Organization, Centre for Development Studies (CDS), the Faculty of Economics of the University of Groningen in the Netherlands, and the School of Economics and Business ... never seen the light of the day without the unstinting support and encouragement of my promotors Professor J Wijngaard and Professor A.C Waszink from the Faculty of Management and Organization I ... the high cost of fully implementing HACCP and other relevant quality standards; (2) the limited understanding of workers as to what the meaning of HACCP and relevant quality standards is, resulting...
... originally wetland and agriculture, has became a modern New Town, combined to the “natural” landscape and green space, and created a motivation for the development of the southern gateway of Hanoi ... development of New settlements in the South-West of Hanoi Figure Land use pattern of Linh Dam (Mapping - Quyen Phuong, 2011) Table Land use planning of Linh Dam (Total area: 1,840,230 m2) Types of use ... traditional architectural style and tropical climate Among these, the outstanding point is the area of highstorey apartments and office buildings in the center of Linh Dam peninsula, surrounding...
... Kasai, H., Sofuni, T and Nohmi, T (1997) Construction of mutants of Salmonella typhimurium deficient in 8-hydroxyguanine DNA glycosylase and their sensitivities to oxidative mutagens and nitro ... 233-246 Yamada, M., Sedgwick, B., Sofuni, T and Nohni T (1995) Construction and characterization of mutants of Salmonella typhimurium deficient in DNA repair of O6-methylguanine, J Bacteriology, ... 2-Nitrofluoranthene, 1-nitropyrene and 1,8-dinitropyrene are tested without S9mix, Glu-P-1 and Trp-P-2 are tested with S9mix using TA98 and YG1041 2-Nitronaphthalene, 2,4-dinitrotoluen and 4-nitroquinoline...
... from the shortage of water The damage [%•day] from the shortage of water is quantified by the product of the percent of deficiency to the water supply demand [%] and the period of deficiency [days] ... 119-124 - 232 - Journal of Water and Environment Technology, Vol.3, No.2, 2005 Rose, J B and Gerba, C P (1991) Use of risk assessment for development of microbial standards Wat Sci and Tech., Vol.24, ... after the medical treatment is calculated as shown in Figure When the symptoms of liver cancer develops, the medical treatment is performed at the age of a, and then the expectation of DALY (DALYa)...
... activities of nitrite oxidizing bacteria - 31 - Journal of Water and Environment Technology, Vol.5, No.1, 2007 Figure Behavior of nitrate and nitrite at the end of the aerobic tank Behavior of Nitrobacter ... The effective reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank Influent was 60L/day pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank ... the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer...
... through the city of Palangkaraya to the Java Sea It is 600 km long and has an average width of 450 m (Statistic of Central Kalimantan Province, 2006) - 104 - Journal of Water and Environment Technology, ... Journal of Water and Environment Technology, Vol 6, No.2, 2008 The concentrations of mercury in the muscle tissues of the fish obtained from the two rivers did not differ from those in the muscle tissues ... with the Japanese Industrial Standard and analyzed by CVAAS (HG-200, Hiranuma) A mercury standard was made from mercury (II) chloride and checked against Hair Standard no 13, obtained from the...
... propose a management method of a water treatment system using the giant reed Fig - Appearances of the Giant Reed, Reed, and Silver Grass - 144 - Journal of Water and Environment Technology, Vol ... The size of rhizomes and the number of stems growing from rhizomes are also different between this study and the natural environment This means that the ratio of the above-ground part of the reed ... Shioda T., Yamada K., Chiba N., and Sudo R (1999) The effect of porosity of packed media on nitrogen and phosphorus removal in reed bed treatment system, Journal of Japan Society on Water Environment...
... that there is a strong link between the amount of eye contact people receive and their degree of participation in group communication in the number of turns taken in a group conversation for example ... a nudge Eye contact is, fundamentally, time and effort saving Much of the above is likely to seem transparently obvious, only natural, and an aspect of human behaviour either innate or developed ... encouragement often, and disapproval occasionally Remind learners that they ought to know an answer or that they could provide a response if they tried Use eye contact as a correction technique Nominate and...
... teaching and learning spoken English of the teachers and the students of 10 th grade at NTT school; the cultural obstacles such as different ways of thinking, lack of cultural background knowledge and ... have become aware of the importance of cultural factors in the teaching of speaking skills and, too , aware of the great influence of inferences between two cultures- target and learner’s cultures- ... students’ language proficiency - 15 - CHAPTER 2: THE STUDY 2.1 Design and methodology 2.1.1 Subjects of the study The subject of the study consists of 100 students of 10th grade and 10 teachers who...
... country of the world, museums have been open to help people understand and appreciate the natural world, the history of civilizations, and the record of humanity’s artistic, scientific, and technological ... objects of scientific, aesthetic, or historical importance for the purposes of public education and the advancement of knowledge The Vietnam Museum of Ethnography founded in 1997 is a cultural and ... Nida, and many others have carried out careful analyses of the process of translating, especially in the case of source and receptor languages having quite different linguistic structures and cultural...