large feathers on a birds wings and tail
A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong
... participation in large classes in Vietnam, particularlyin higher institutions.The above situation of teaching large classes and the gap of knowledge in theresearch area have aroused my interest and ... class on time, take notes what teachers say and write down on the black board, and stay in the class all the time and get to know the teacher. Studentswho are active and attentive, that means, ... question the theoretical assumptionunderlying Situational Language teaching. (Richards and Rodgers 1991:64)As the scope of Communicative Language Teaching has expanded, it was consideredas an approach...
- 42
- 616
- 2
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"
... with a con-genital primary lymphedema [14]. Conclusions Assessing the impact of the duration and sever-ity of the condition in relation to age, sex and occupa-tional status as influential ... disorders. A conventional approach was applied, involving eleva-tion of the affected limb, massage, physical activity and compression with elastic stockings. On physical examination she presented a ... the calf, thigh and inguinal area leading to disfigurement and functional impairment. The patient had a negative family history of edema. He received a diagnosis of primary lym -phedema at...
- 5
- 443
- 0
A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school
... important in language teaching. In fact, nearly all of the teachers at DL1USS are very young and energetic as well as they have a good background of vocabulary and grammatical structures. They are ... Positions of speaking in language teaching programs, Difficulties in and constraints on learning to speak a foreign language, and Factors affecting students’ participation in speaking activities.Chapter ... vocabulary is not enough and their pronunciation is not good, which makes them hard to listen and speak. Only one interviewee says that he is good at listening and speaking and wants to learn...
- 44
- 841
- 0
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
... That’s why ADC, The Broadband Company™ and the industry’s leading supplier of DSX-1equipment, continues to innovate and enhance traditional DSX panels toimprove density, manageability, and ... and bays, and you can save valuable floor space. Byconfiguring a low-profile 84-circuit DSXi panel measuring only four inches high,you can increase your bay capacity from 11 standard panels ... Signal Cross-connect) panels are an integral part of operating and maintainingcommunications networks. As technology continues to become moresophisticated, DSX panels remain at the very heart...
- 6
- 378
- 0
Tài liệu Discourses on a Sober and Temperate Life doc
... isnaturally of a bad constitution, may, in like manner, by dint of reason, and a sober life, live to a great age and in good health, as I have done, who had naturally the worst, so that it was ... donations from donors in such stateswho approach us with offers to donate.International donations are gratefully accepted, but we cannot make any statements concerning tax treatmentof donations ... in a very advanced age through a mere dissolution of his elementary parts; as was the case,in Venice, of the procurator Thomas Contarini; and in Padua, of the cavalier Antonio Capo di Vacca....
- 29
- 400
- 0
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... 596-1887, email business@pglaf.org. Email contact links and up todate contact information can be found at the Foundation's web site and official page at http://pglaf.orgFor additional contact ... current donation methods and addresses. Donations areaccepted in a number of other ways including checks, online payments and credit card donations. To donate,please visit: http://pglaf.org/donateSection ... are annually squandered in the various departments of raising,preparing, and consuming this plant; and to point out, if they can, in what manner a poison so deadly acts on A Dissertation on the...
- 29
- 586
- 0
Tài liệu Youth Safety on a Living Internet: Report of the Online Safety and Technology Working Group pptx
... been a significant move away from a rather fear-based approach and [toward] using more research of actual harm.” Balkam said there are still some challenges. “Some companies are rather disconnected ... Group heard from Jessica Gonzales of the National Hispanic Media Coalition and Steve Sheinberg from the Anti-Defamation League about the impact of hate content on youth. Ms. Gonzales warned of ... parent/teachers guide to educate 9-15 year olds about Cyber Bullying, CyberPredators and Plagiarism. School assembly details are also available.Education, CommercialAT&T Education Advocates...
- 148
- 435
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... ArgRS, Arg and tRNAArgICGgrow contains tRNA, l-Arg, ATP and Mg2+at sufficient concentrations for the aminoacyla-tion reaction, and (NH4)2SO4 and 1,6-hexanediol areused as precipitating agents ... codon usages for AGA and AGG co-dons are 19 and 34, respectively, and they amount to 98%among six codons for Arg. The D-loops of isoacceptortRNAUCU and tRNACCUcontain nine (AGCAGGAC2 0a A) and ... reaction, the Arg-NHOH formationreaction, and the deacylation reaction. (A) Arg (cyan), ATP (orange) coordinated by Mg2+ and A7 6 (green) of tRNA assisting the Arg-AMP for-mation reaction on P. horikoshii...
- 17
- 512
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites ... forphosphorus scavenging and remobilization when thecells are under stress and consequently mononucleotidephosphate concentrations are high.Materials and methodsCloning and purification of St SurEThe ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt
... involves capture of the electroninto an amide carbonyl group that is hydrogen bondedto the protonated side chain of a basic amino acid.The resulting radical anion abstracts a proton and gen-erates ... them with a second anion that functions as a baserather than an electron donor. The carboxylate anionof benzoic acid satisfies this requirement and deproto-nates the multiply charged fragments. ... McLuckey SA (2006) Alternatelypulsed nanoelectrospray ionization ⁄ atmospheric pres-sure chemical ionization for ion ⁄ ion reactions in an elec-trodynamic ion trap. Anal Chem 78, 3208–3212.26 Montgomery...
- 8
- 578
- 0
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... Providinginformation that i s congruent with a patient ’sneedsatthat particular time is an important determinant forpatient satisfaction and affects health-related quality oflife (HRQoL) and anxiety and ... information provision, and availability; thenurses’ technical skills, interpersonal skills, informationprovision, and availability; the other hospital staff’s inter-personal skills and information ... status, and clinical variables such as cancerstage at diagnosis, time after diagnosis, and initial treat-ment. All measures will be collected at the beginning ofthe trial, and at 6, 12, 18 and...
- 8
- 786
- 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... Henry Fonda, and Karl Malden). And since these magical beings are watching and clapping along with a (newly) global “us” in the virtual audience, all the more reason the montage must mean something. ... celebration of spectatorship as accumulation and consumption. Accumulation is an endemic feature of the cultural landscape of the information society, according to Scott Lash, who characterizes ... increasingly problematized in the era of the global popular film market, is also a magic word. At once a place in Los Angeles, an industrial marker and a mythical land, it is emblematic of contemporary...
- 10
- 612
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... representation and as propor-tional covers for statistical analysis. Repeated-measures analysis ofvariance (ANOVA) was used to compare the proportional coversof individual substrate components among ... personal communication; R.B .A. and W.F.P., personal observation). As a result, E. viridis hasbeen the most abundant herbivore at Channel Cay and the other shoals for decades at least, and it consumedmost ... quadrats at the sametime as juvenile corals. Stations 1 and 2 were sampled in 1994 with51 quadrats at each depth at each station. Station 3 was added forthe 1999–2001 counts, and 25 quadrats...
- 13
- 583
- 0
Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf
... Very Large Corpora.Kiyotaka Uchimoto, Qing Ma, Masaki Murata, Hi-romi Ozaku, Masao Utiyama, and Hitoshi Isahara.2000. Named entity extraction based on a maxi-mum entropy model and transformation ... .According to this ordering, two candidates canhave the same rank. One of them might assert that a certain word is an organization’s name and an-other candidate might assert that it is a person’sname. ... <ORGANIZATION>OO-SAKA-TO-YO-TA</ORGANIZATION> (= Os-aka Toyota) because Japanese POS taggers knowthat TO-YO-TA is an organization name (a kindof proper noun).*:*:location-name,...
- 8
- 530
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25