Ngày tải lên: 31/03/2014, 06:20
... participation in large classes in Vietnam, particularly in higher institutions. The above situation of teaching large classes and the gap of knowledge in the research area have aroused my interest and ... class on time, take notes what teachers say and write down on the black board, and stay in the class all the time and get to know the teacher. Students who are active and attentive, that means, ... question the theoretical assumption underlying Situational Language teaching. (Richards and Rodgers 1991:64) As the scope of Communicative Language Teaching has expanded, it was considered as an approach...
Ngày tải lên: 05/02/2014, 22:02
Báo cáo toán học: "A note on constructing large Cayley graphs of given degree and diameter by voltage assignments" pdf
Ngày tải lên: 07/08/2014, 06:22
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"
... with a con- genital primary lymphedema [14]. Conclusions Assessing the impact of the duration and sever- ity of the condition in relation to age, sex and occupa- tional status as influential ... disorders. A conventional approach was applied, involving eleva- tion of the affected limb, massage, physical activity and compression with elastic stockings. On physical examination she presented a ... the calf, thigh and inguinal area leading to disfigurement and functional impairment. The patient had a negative family history of edema. He received a diagnosis of primary lym - phedema at...
Ngày tải lên: 25/10/2012, 11:40
A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school
... important in language teaching. In fact, nearly all of the teachers at DL1USS are very young and energetic as well as they have a good background of vocabulary and grammatical structures. They are ... Positions of speaking in language teaching programs, Difficulties in and constraints on learning to speak a foreign language, and Factors affecting students’ participation in speaking activities. Chapter ... vocabulary is not enough and their pronunciation is not good, which makes them hard to listen and speak. Only one interviewee says that he is good at listening and speaking and wants to learn...
Ngày tải lên: 07/11/2012, 14:44
Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium
Ngày tải lên: 05/09/2013, 14:58
A study on syntactic, lexical semantic and rhetorical features of word groups containing words denoting seasons in vietnamese and english
Ngày tải lên: 26/11/2013, 13:16
A study on prepositions of direction and some errors made by vietnamese learners
Ngày tải lên: 11/12/2013, 23:53
A STUDY ON UNREAL CONDITIONAL SENTENCES AND WAYS TO TRASLATE THEM INTO VIETNAMESE
Ngày tải lên: 11/12/2013, 23:57
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
... That’s why ADC, The Broadband Company ™ and the industry’s leading supplier of DSX-1 equipment, continues to innovate and enhance traditional DSX panels to improve density, manageability, and ... and bays, and you can save valuable floor space. By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels ... Signal Cross-connect) panels are an integral part of operating and maintaining communications networks. As technology continues to become more sophisticated, DSX panels remain at the very heart...
Ngày tải lên: 21/12/2013, 07:15
Tài liệu Discourses on a Sober and Temperate Life doc
... is naturally of a bad constitution, may, in like manner, by dint of reason, and a sober life, live to a great age and in good health, as I have done, who had naturally the worst, so that it was ... donations from donors in such states who approach us with offers to donate. International donations are gratefully accepted, but we cannot make any statements concerning tax treatment of donations ... in a very advanced age through a mere dissolution of his elementary parts; as was the case, in Venice, of the procurator Thomas Contarini; and in Padua, of the cavalier Antonio Capo di Vacca....
Ngày tải lên: 17/02/2014, 22:20
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... 596-1887, email business@pglaf.org. Email contact links and up to date contact information can be found at the Foundation's web site and official page at http://pglaf.org For additional contact ... current donation methods and addresses. Donations are accepted in a number of other ways including checks, online payments and credit card donations. To donate, please visit: http://pglaf.org/donate Section ... are annually squandered in the various departments of raising, preparing, and consuming this plant; and to point out, if they can, in what manner a poison so deadly acts on A Dissertation on the...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Youth Safety on a Living Internet: Report of the Online Safety and Technology Working Group pptx
... been a significant move away from a rather fear-based approach and [toward] using more research of actual harm.” Balkam said there are still some challenges. “Some companies are rather disconnected ... Group heard from Jessica Gonzales of the National Hispanic Media Coalition and Steve Sheinberg from the Anti-Defamation League about the impact of hate content on youth. Ms. Gonzales warned of ... parent/teachers guide to educate 9-15 year olds about Cyber Bullying, CyberPredators and Plagiarism. School assembly details are also available. Education, Commercial AT&T Education Advocates...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... ArgRS, Arg and tRNA Arg ICG grow contains tRNA, l-Arg, ATP and Mg 2+ at sufficient concentrations for the aminoacyla- tion reaction, and (NH 4 ) 2 SO 4 and 1,6-hexanediol are used as precipitating agents ... codon usages for AGA and AGG co- dons are 19 and 34, respectively, and they amount to 98% among six codons for Arg. The D-loops of isoacceptor tRNA UCU and tRNA CCU contain nine (AGCAGGAC 2 0a A) and ... reaction, the Arg-NHOH formation reaction, and the deacylation reaction. (A) Arg (cyan), ATP (orange) coordinated by Mg 2+ and A7 6 (green) of tRNA assisting the Arg-AMP for- mation reaction on P. horikoshii...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites ... for phosphorus scavenging and remobilization when the cells are under stress and consequently mononucleotide phosphate concentrations are high. Materials and methods Cloning and purification of St SurE The ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt
... involves capture of the electron into an amide carbonyl group that is hydrogen bonded to the protonated side chain of a basic amino acid. The resulting radical anion abstracts a proton and gen- erates ... them with a second anion that functions as a base rather than an electron donor. The carboxylate anion of benzoic acid satisfies this requirement and deproto- nates the multiply charged fragments. ... McLuckey SA (2006) Alternately pulsed nanoelectrospray ionization ⁄ atmospheric pres- sure chemical ionization for ion ⁄ ion reactions in an elec- trodynamic ion trap. Anal Chem 78, 3208–3212. 26 Montgomery...
Ngày tải lên: 18/02/2014, 16:20
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... Providing information that i s congruent with a patient ’sneedsat that particular time is an important determinant for patient satisfaction and affects health-related quality of life (HRQoL) and anxiety and ... information provision, and availability; the nurses’ technical skills, interpersonal skills, information provision, and availability; the other hospital staff’s inter- personal skills and information ... status, and clinical variables such as cancer stage at diagnosis, time after diagnosis, and initial treat- ment. All measures will be collected at the beginning of the trial, and at 6, 12, 18 and...
Ngày tải lên: 05/03/2014, 15:20
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... Henry Fonda, and Karl Malden). And since these magical beings are watching and clapping along with a (newly) global “us” in the virtual audience, all the more reason the montage must mean something. ... celebration of spectatorship as accumulation and consumption. Accumulation is an endemic feature of the cultural landscape of the information society, according to Scott Lash, who characterizes ... increasingly problematized in the era of the global popular film market, is also a magic word. At once a place in Los Angeles, an industrial marker and a mythical land, it is emblematic of contemporary...
Ngày tải lên: 07/03/2014, 15:20
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... representation and as propor- tional covers for statistical analysis. Repeated-measures analysis of variance (ANOVA) was used to compare the proportional covers of individual substrate components among ... personal communication; R.B .A. and W.F.P., personal observation). As a result, E. viridis has been the most abundant herbivore at Channel Cay and the other shoals for decades at least, and it consumed most ... quadrats at the same time as juvenile corals. Stations 1 and 2 were sampled in 1994 with 51 quadrats at each depth at each station. Station 3 was added for the 1999–2001 counts, and 25 quadrats...
Ngày tải lên: 07/03/2014, 17:20