laminar flow of nonnewtonian fluids in a horizontal pipe

Ngày tải lên: 13/08/2014, 02:24

... attenu- ated. In this study, the Kappa coefficient of agreement test on smoking habits of couples were 0.076 in urban areas, and 0.163 in rural areas, indicating a very weak association between ... initial design and final analysis based on symmetric CIs for estimation using a normal CI ap- proach. Second, a large adequate sample size in each compared group will make a high probability ... patterns in urban and rural areas was used as a surrogate analy- sis by socioeconomic status. In conclusion, the basic principles of equivalence are also supported by epidemiological survey data....

Ngày tải lên: 26/10/2012, 09:48

Ngày tải lên: 05/09/2013, 16:11

... all records from table TBL0709 in the sample database and to update changes made back to the database. The DataAdapter is used to fill a DataTable in a new DataSet with the schema and data ... binding manager base for the table. [ Team LiB ] Recipe 7.9 Binding a Group of Radio Buttons in a Windows Form Problem You need to bind a field in a database to a radio button and update ... is a DataSet. For a DataTable, an overload of the BindingContext indexer is used that takes only the data source argument. 6. Attach an event handler for the PositionChanged event of the BindingManagerBase....

Ngày tải lên: 07/11/2013, 13:15

... decompose a surface with quadatric curvature decay into disjoint almost stable subdomains and a “remainder” with quadratic area growth. For applications of the results of this part in [CM5], ... the area given in Corollary II.3.16 below. PLANAR DOMAINS 527 A “pair of pants” (in bold). Graphical annuli (dotted) separate the “pairs of pants”. Figure 4: Decomposing the Riemann examples into ... Corollary 0.4: Solving a Plateau problem gives a stable graphical annulus separating the boundary components of an embedded minimal annu- lus. Stability of Γ in Theorem 0.3 is used in two ways:...

Ngày tải lên: 14/02/2014, 17:20

...

Ngày tải lên: 15/02/2014, 13:20

... classi- fier, using character 1- through 6-grams (including word boundaries) as features. Since we could not manually annotate a large portion of the MZEE cor- pus, the training data consisted of ... English inclusions in mixed-lingual data with an application to parsing. Ph.D. thesis, Institute for Communicat- ing and Collaborative Systems, School of Informatics, University of Edinburgh. Eduardo ... (DAAD) Graduate Research Grant. Julia Hockenmaier is supported by the National Sci- ence Foundation through CAREER award 1053856 and award 0803603. The authors would like to thank Dr. Marina...

Ngày tải lên: 19/02/2014, 19:20

... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. Dynamic ... models are incomplete models that include only the information needed for an application and to which information can be added. Dynamic models are basically approximations of larger conventional ... This mechanism is a correlate of that of Thomason [1980], with the addition of meaningful names to intensional objects serving the same purpose as Thomason's additional layer of types....

Ngày tải lên: 21/02/2014, 20:20

... looks mainly to cases decided in the United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule -of- law project capable of responding to situations ... the Reports and found that he was right in every particular, and a page and a half of that judgment is really in that way the work of General Smuts rather than myself. 15 Foxton continues that Shaw was ... within a common law legal order which they make sense of in accordance with the rigid doctrine of theseparation of powers; and, finally, functionalism, a theory of the administrative state that...

Ngày tải lên: 07/03/2014, 02:20

... But my argument is in part based in the fact that the kinds of claims that are made about states of emergency occur also in quite ordinary situations, for example, claims that the rule of law does ... is about law or legal order, including international legal order, not just about the values inherent in the law of a particular legal order orfamilyof legal orders. Moreover, Iwant to claim that ... differ from each other, sometimes quite dramatically, in the way they arrange the institutions that are principally involved in bringing the principles of the rule of law to realization. In fact, the...

Ngày tải lên: 07/03/2014, 02:20

... preparation of recombinants in yeast expression vector In the case of AACEVAPD1, 3 and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln). Conversion of TAA to CAA was performed ... forms a functional proton channel [2]. Acetabularia acetabulum, a giant unicellular marine alga, belongs to the Dasycladaceae family. We have already reported the presence of V-ATPase in this organism ... R. & Oesterhelt, D. (1990) A Cl – -translocating adenosinetriphosphatase in Acetabularia acetabulum. 1. Purifi- cation and characterization of a novel type of adenosinetriphos- phatase that...

Ngày tải lên: 08/03/2014, 23:20

... near a point of large curvature. Theorem 0.3 is particularly useful when combined with a result from [CM4] asserting that an embedded minimal disk with large curvature at a point con- tains a small, ... understanding such surfaces is to un- derstand the local structure in a ball and in particular the structure of an embedded minimal disk in a ball in R 3 (with the flat metric). This study is undertaken ... keep in mind is the portion of a (rescaled) helicoid in a slab between two cylinders about the vertical axis. This gives (two) multi-valued graphs over an annulus; removal of a vertical half-plane...

Ngày tải lên: 14/03/2014, 22:20

... knowledge, attitudes and practices of specialist physicians in a tertiary–care hospital as to: a. their idea of the magnitude of TB problem in the Philippines b. their opinion of the National TB ... (n=36) of physicians fail to notify the health authority regarding pulmonary TB cases because of the lack of awareness among 53% (n=20) and because of paperwork involved in 26% (n=10) of respondents. ... 1376-1395. 8. Manalo MFC, Pineda AV, Montoya JC. Knowledge, attitudes and practices for tuberculosis among Filipino Family Physicians: a comparative analysis by practice setting and location. Phil...

Ngày tải lên: 15/03/2014, 03:20

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC T3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC MG3X ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC XHO-TNF13 ... Yoshiyuki Kayano, Sayaka Nakao, Nagisa Sakurai, Hiroyuki Iwata 1 and Rumi Ishisaka Department of Biological Chemistry and 1 Department of Veterinary Medicine, Faculty of Agriculture, Yamaguchi University, Yamaguchi,...

Ngày tải lên: 16/03/2014, 16:20

... effort has already been invested in mathematical modelling of the glycolytic pathway in yeast [3–8] and in other organisms, such as Trypanosoma brucei, the parasite that causes sleeping sickness ... evolutionary effort required to develop and maintain this set of biological checks and balances is intuitively indicative of some importance to maintaining consistent rates of glucose transport, ... metabolite concentration and flux are obtained from populations of yeast cells and so reflect an aggregate of the states of many individual organisms. Although no fitted model in this paper individually...

Ngày tải lên: 17/03/2014, 11:20

Ngày tải lên: 17/03/2014, 19:21

Ngày tải lên: 18/03/2014, 01:20

Ngày tải lên: 18/03/2014, 02:20