l and ls g - 123doc

Báo cáo khoa học: Structure–function relationship of novel X4 HIV-1 entry inhibitors – L- and D-arginine peptide-aminoglycoside conjugates pptx

Ngày tải lên : 16/03/2014, 06:20

... cMAGI HIV-1 reporter cells were cultured in DMEM, containing 10% fetal bovine serum and antibiotics (100 UÆmL)1 penicillin; 100 lgÆmL)1 streptomycin; 0.25 lgÆmL)1 fungizone; 200 lgÆmL)1 G4 18; lgÆmL)1 ... the cell (6- and 9-mers) peptideaminoglycosides are readily internalized and concentrated in the cell nucleus and extra-nuclear organelles Neo-R9 Fig Confocal microscopy images of cMAGI cells stained ... ﬁndings that d-conﬁguration arginine-rich cell penetrating peptides were completely stable, whereas their l- analogues were degraded in HeLa cells [15,16] Accordingly, the lower EC50 of the d ⁄ l- 9-mer-arginine...

14
433
0

Báo cáo khoa học: Characterization of c-tocopherol methyltransferases from Capsicum annuum L and Arabidopsis thaliana pptx

Ngày tải lên : 17/03/2014, 09:20

... after SDS-gel electrophoresis of the Blue Sepharose column fraction (Fig 4A) and agrees with the molecular mass of c-TMT from A thaliana (Fig 4B) The presence of only one labelled band is also indicative ... divalent cations, BSA and yolk lipids had no protective influence on the stability of the enzyme (data not shown) Molecular mass determination Gel filtration (Fig 3) and photoaffinity labelling followed ... After electrophoresis the gel was stained with Coomassie Brilliant blue reaction, proteins were separated on SDS gel electrophoresis Imaging analysis revealed the presence of one single labelled...

9
581
0

Báo cáo sinh học: "Multiplex Zymography Captures Stage-specific Activity Profiles of Cathepsins K, L, and S in Human Breast, Lung, and Cervical Cancer" potx

Ngày tải lên : 18/06/2014, 22:20

... Szabova L, Yamada SS, Wimer H, Chrysovergis K, Ingvarsen S, Behrendt N, Engelholm LH, Holmbeck K: MT1-MMP and type II collagen specify skeletal stem cells and their bone and cartilage progeny J ... associated macrophages, blood vessels, white blood cells, or any other infiltrating cells with cathepsin activity will be captured in that tissue extract Aggressive tumor cells are able to recruit ... activity and regulatory mechanisms Cathepsin K is the most potent mammalian collagenase, capable of cleaving type I collagen in the native triple helix and in the telopeptide regions while other collagenases...

13
382
0

báo cáo hóa học: " Leader (L) and L* proteins of Theiler''''s murine encephalomyelitis virus (TMEV) and their regulation of the virus'''' biological activities" docx

Ngày tải lên : 19/06/2014, 22:20

... L* -expressing J774-1 cell line GDVII and DAL*-1 viruses not grow in control cells, which not express L* , whereas virus growth is enhanced in L* -expressing cells [51] van Eyll et al also have shown that L* ... the virus grew well in BHK-21 cells [50] In addition, DAL*-1 virus failed to grow in other macrophage cell lines, suggesting that L* plays an important role in host celldependent subgroup-specific ... designated leader (L) and L* that are located in the N end of the polyprotein (Fig 2) also play a role in TMEV biological activities [2,3,12] The present review focuses on the roles of L and L* ...

8
447
0

báo cáo khao học 'rapid seedling obtaining from european ash species fraxinus excelsior (l.) and fraxinus angustifolia (vahl.)'

Ngày tải lên : 30/06/2014, 05:04

... al Botanical traits of the two species generally allow to distinguish them but some individuals cannot be easily classified In the sympatric areas, (e .g Saône valley) well grown ash individuals ... stages of germination and development are presented in figures and Embryos of F angustifolia are generally larger than embryos of F excelsior (figure 1b) They underwent root elongation as early ... additional lighting was given by lamps Philips SONT400W when necessary, one lamp per m2 Only plants alive that produced at least leaves (cotyledonary leaves excluded) were counted at and weeks...

6
385
0

Lop 9 - Unit 3 (G.t,L and R)

Ngày tải lên : 16/07/2014, 02:00

... their family A feel like B like feel D feels like C feel Choose the best answer 5.He the chickens and collects their eggs after school A.feeds B takes C feed D helps 7.How long Van will stay there ... column B A B maize a bring things together feed b.where people buy food and small things 3.grocery store c give food to eat part-time d corn collect e.shorter or less than standard time b.Complete ... and collects their eggs  two  the chickens T The Parker family and Van eat hamburgers or hot dogs while they watch Peter play 2 Exercises a Match the words in column A with the words or groups...

19
560
0

Báo cáo lâm nghiệp: "New insights in the recognition of the European ash species Fraxinus excelsior L. and Fraxinus angustifolia Vahl as useful tools for forest management" pdf

Ngày tải lên : 07/08/2014, 16:20

... Enniskillen Currachase Wytham Settrington La Romagne Athis St-Gatien St-Paul-de-S Dourdan Orsay Alençon Overall F angustifolia Alter Chao Boujan-sur -L Grabels Mas-Larrieu Cogolin La Mole Cuxac ... GGAAGTCGCCCTTAGACTTTG FaH299R GCCAAATGGCCTTACACAAC FaL757F CAGCTTGGTGAGCGATCC FaL757R CCAGCAGCTTCACAAGGTTA FaH1549F GAAGTCGCCGCTATCAAGTAA FaH1549R GGAAGTCGCCCTCTTTTGC ( C) (%) 1-21 21 59.8 52.4 273-292 20 57.3 ... F19LgF TTGATATAGGAATGCCAGAGC 3-23 21 57.0 42.9 F19LgR CAGATACTCGCGTATGATGGTC 436-457 22 59.6 50.0 Position in the SCAR-RAPD sequence F and R represent forward and reverse primers, respectively...

6
521
0

Báo cáo lâm nghiệp: " Optimising the management of uneven-aged Pinus sylvestris L. and Pinus nigra Arn. mixed stands in Catalonia, north-east Spain" pps

Ngày tải lên : 08/08/2014, 00:21

... a–1), and 2164.8 euro ha–1 (3.11 m3 ha–1 a–1), respectively The optimal management was similar for medium and high site levels, the initial stand volume being slightly higher for high fertility levels ... drawing the initial tree diameters from a Weibull distribution, a stand growth and yield simulator based on individual-tree growth, height, ingrowth and survival models, and an optimisation algorithm, ... diameter growth models High and low site fertility levels were defined using the standard deviation (SD) of the plot factor in the diameter growth modelling data (see [37]) A plot factor equal to...

12
412
0

Báo cáo lâm nghiệp: "Variations of construction cost associated to leaf area renewal in saplings of two co-occurring temperate tree species (Acer platanoides L. and Fraxinus excelsior L.) along a light gradient" doc

Ngày tải lên : 08/08/2014, 00:22

... starting in May 1st and ending in August 31th 2.3 Sampling and analysis Thirty saplings of Acer platanoides L and 26 saplings of Fraxinus excelsior L were sampled in the stand in a large range of light ... A platanoides (closed symbols) and F excelsior (open symbols) Determination coefficients (r2) and linear regression lines (full line for A platanoides and dotted line for F excelsior) are given ... platanoides (closed symbols) and F excelsior (open symbols) Determination coefficients (r2) and linear regression lines (full line for A platanoides and dotted line for F excelsior) are given when significant...

7
324
0

Báo cáo lâm nghiệp: "Aboveground biomass relationships for mixed ash (Fraxinus excelsior L. and Ulmus glabra Hudson) stands in Eastern Prealps of Friuli Venezia Giulia (Italy)" pptx

Ngày tải lên : 08/08/2014, 00:22

... Concepts and field methods, Ecol Appl 11 (2001) 356–370 [5] Del Favero R., Poldini L. , Bortoli P .L. , Dreossi G. F., Lasen C., Vanone G. , La vegetazione forestale e la selvicoltura nella regione Friuli ... power models (1) That is equivalent to: Log (B) = log (a) + b log (D) Figure Relationship between diameter at breast height (D in cm) and total height (H in m) (● ash and ■ wych elm; solid line is ... (Ulmus glabra Hudson) (5%), bird cherry (Prunus avium L. ) (4%), alder (Alnus glutinosa) (4%), broad-leaved lime (Tilia platyphyllos Scopoli), chestnut (Castanea sativa Miller) and some individuals...

6
311
0

Báo cáo lâm nghiệp: " Eﬀect of species and ecological conditions on ellagitannin content in oak wood from an even-aged and mixed stand of Quercus robur L. and Quercus petraea Liebl." docx

Ngày tải lên : 08/08/2014, 00:22

... carried out for all the ellagitannins traits (individual ellagitannin content, ellagic acid content, total ellagitannin content, percentage of individual ellagitannin, vescalagin/castalagin ratio) ... according to three ecological zones (plateau, slope, small valley) the eﬀects of these ecological conditions and species were investigated globally and individually Different statistical methods could ... functional analysis (DFA) DFA was carried out using all ellagitannin traits (individual ellagitannin content, ellagic acid content, total ellagitannin content, percentage of individual ellagitannin,...

10
253
0

Báo cáo lâm nghiệp:"Predicting the probability of seed germination in Pinus sylvestris L. and four competitor shrub species after fire" doc

Ngày tải lên : 08/08/2014, 01:21

... using maximum likelihood function The models were selected using the change in the value of – log likelihood between the model with and without explanatory variables [22] Plant nomenclature follows ... italics are not significant using a probability level of 0.05 Table III Coefficients of the selected logistic models Species Pinus sylvestris Halimium umbellatum Halimium alyssoides Genista florida ... to analysing the germination pattern of Scots pine and four potential competitors following thermal treatment Finally, conclusions allow the development of management strategies to help regenerate...

7
355
0

Báo cáo lâm nghiệp:"Growth and biomass partitioning of Fagus sylvatica L. and Quercus robur L. seedlings in response to shading and small changes in the R/FR-ratio of radiation" pot

Ngày tải lên : 08/08/2014, 01:21

... further development of growth models will benefit from integrating the effect of light quality on growth, at least for light demanding species [20, 41] In addition silviculture in general 170 Ch ... slightly changed light quality will be change over time Evidence exists that for oak maximum growth and optimum light conditions change with age [55] and that biomass allocation patterns in general ... of blue/ultraviolet-A light and light absorbed by phytochrome in controlling growth of pine (Pinus sylvestris L. ) seedlings, Planta 180 (1990) 212–216 [17] Gansert D., Sprick W., Storage and...

9
341
0

Báo cáo lâm nghiệp: "Using past growth to improve individual-tree diameter growth models for uneven-aged mixtures of Pinus sylvestris L. and Pinus nigra Arn. in Catalonia, north-east Spain" doc

Ngày tải lên : 08/08/2014, 01:21

... × + β4× BALsyl lk + β × ln( dbhlkt ) + β × dbhlkt ln( dbhlkt + 1) BALnig + acc lk ln( dbhlkt + 1) + β5× BALthin lk + β × ln (G ) lk ln( dbhlkt + 1) + β × ln(GI lk ) + u l + u lk + elkt (3) 412 ... (5)) and P nigra (Eq (6)) were as follows: u lk = β + β1 × ELE lk + β × ( ELE lk ) + β × SLOlk + elk (5) u lk = β + β1 × ln( ELE lk ) + β × SLOlk + β × CON lk + β × LAT lk + elk (6) where ulk is ... (RMSE) were calculated as follows: bias = BALsyl + acc lk BALthin lk + β4× + β5× + β × ln( GI lk ) + u l + u lk + elkt ln( dbh lkt + 1) ln( dbh lkt + 1) (4) where id10 is future diameter growth (cm...

9
304
0

Báo cáo lâm nghiệp: "Influence of herbaceous competitors on early growth in direct seeded Fagus sylvatica L. and Quercus robur L" ppt

Ngày tải lên : 08/08/2014, 01:22

... elemental analyzer (Carlo Erba NA 1500, Carlo Erba Strumentazione, Italy) 2.3 Calculations The leaf area per seedling was calculated using the total leaf dry mass per seedling and the ratio leaf ... (Fagus sylvatica L. ) seedlings in relation to shading and drought, Ann Sci For 54 (1996) 9–18 [38] Welander N.T., Ottosson B., The influence of shading on growth and morphology in seedlings of ... Kolb T.E., Steiner K.C., McCormick L. H., Bowersox T.W., Growth response of northern red-oak and yellow poplar seedlings to light, soil moisture and nutrients in relation to ecological strategy,...

8
295
0

Báo cáo lâm nghiệp: "Growth and yield model for uneven-aged mixtures of Pinus sylvestris L. and Pinus nigra Arn. in Catalonia, north-east Spain" pptx

Ngày tải lên : 08/08/2014, 01:22

... (3)) and P nigra (Eq (4)) were as follows: u lk = β + β × ELE lk + β × ( ELE lk ) + β × SLO lk + e lk (3) u lk = β + β × ln ( ELE lk ) + β × SLO lk + β × CON lk + β × LAT lk + e lk (4) where ulk ... and P nigra (Eq (9)) were estimated using the ordinary least squares (OLS) method in SPSS [35]: Gsyl lk (8) ING lk = β + β × G lk + β × - + β × - + e lk G lk G lk Gnig lk CON lk ING ... ln ( dbh lkt + ) ln ( dbh lkt + ) BALthin lk + β × + u l + u lk + e lkt ln ( dbh lkt + ) ln ( id10 lkt ) = β + β × + β × ln ( dbh lkt ) dbh lkt BALsyl lk BALnig +...

16
288
0

Báo cáo lâm nghiệp: "Leaf morphology as species indicator in seedlings of Quercus robur L. and Q. petraea (Matt.) Liebl.: modulation by irradiance and growth flush" potx

Ngày tải lên : 08/08/2014, 01:22

... pilosity density PPL: hair length on the petiole, graded from (hairless) to (very long) MPL: hair length on the midrib LPL: hair length on the lamina Calculated variables PRL: relative length ... PRL: relative length of the petiole, PL / (LL+PL) (%) LRW: relative width of the lamina, LW / LL (%) LWRL: relative length of lamina at largest width, LWL / LL (%) ARPE: surface area to perimeter ... Variable ELD *** * *** RLIV *** PERINL *** *** LL LWL PERI AREA LOBL MCA axis2 LW LOBT MASS ARPE PERINL LOBH MCA axis1 PL LRW NLOB ELD ISOP NLUB LMA PRL Species LRW * * *** *** *** LUBLOB *** ***...

8
239
0

Báo cáo khoa học: " Effects of fertilization on the vascular ground vegetation of European beech (Fagus sylvatica L.) and sessile oak (Quercus petraea (Matt.) Lieb.) stands" ppsx

Ngày tải lên : 08/08/2014, 14:21

... Mull 0.17 (1) Corylus avellana Mesotrophic Mull Malus sylvestris Mesotrophic Mull Polygonatum multiflorum Mesotrophic Mull Scrophularia nodosa Mesotrophic Mull Arum maculatum Polytrophic Mull ... LF = Luzulo fagetum, LQ = Luzulo quercetum Table II Location of the experimental stands in the Ecological Sectors of the Belgian Ardenne and climatic characteristics Stand code Ecological Sectors1 ... knowledge of H and H' allows us to calculate the equitability coefficient as: e= H H' = H log S Finally, to interpret the possible changes of species in terms of ecological variation after fertilization,...

14
234
0

Báo cáo khoa học: "Detecting the impact of climate and disturbances on tree-rings of Fagus sylvatica L. and Quercus robur L. in a lowland forest in Cantabria, Northern Spain" ppt

Ngày tải lên : 08/08/2014, 14:21

... for his helpful advice on dendrochronological methodology, and Luis Cabo for English language assistance The comments and suggestions of two anonymous reviewers greatly improved the quality of ... modeling of the residuals and biweight robust estimation of the mean were used to calculate the chronology indices in this method Method was only applied to radial growth series belonging to group ... variation could not be exactly established (4) The unaffected chronologies are not perfect “controls” for the climatic signal because all tree-ring series reflect varying degrees of both climatic and...

15
329
0