key characteristics of the design method

... individuals. The lack of a unified “theory of ecology” and the existence instead of a fragmented body of “ecological theory”is evidenced by the relative use of these two terms in the scientific ... alternative to the “theory of evolution”for explaining the diversity of life on Earth and the ex- istence of millions of different species. Opponents of this view hold that ID is not a scientific theory ... understanding of the t erm “scientific theory,”it is anachro- nistic to use the phrase “theory of evo- lution.”What constitutes a self-contained scientific theory is a subject of much philosophical...

Ngày tải lên: 25/01/2014, 08:20

... Given that the roles of these residues definitely confirm each other, the dif- ference in their significance might be attributable to the importance and ⁄ or necessity of the receipt of the phenol-hydroxyl ... environments of BPA in the ligand-binding pocket of the ERRc. The proximity of each amino acid residue (within a distance of 5 A ˚ ) to BPA is shown in the boxes depicting the a -heli- ces. The portrait ... for the major role of Arg316 in arresting the ligand When the amino acid sequences of the LBD of all the NRs were aligned to that of ERRc, it became notice- able that 26 receptors among the total...

Ngày tải lên: 18/02/2014, 16:20

... and HMBC spectra of compound 1. Labels illustrate assignment of the amide linkage between the amino group of Asp and the carboxyl group of GalA residue E. Scheme 1. The structures of o ligosaccharides ... 76.56 corresponded to the loss of the nonreducing end C-G-A unit and ammonium from the molecular ion. Further fragmentation gave the fragment ion at m/z 1436.42, owing to the loss o f the branching xylose ... isolation Isolation of LGL from S. aurantia. Bacteria were harves- ted f rom a total of 55 L of SGM and the c ombined cell pellet was extracted fo llowing the method of Darveau & Hancock [ 22]. The final...

Ngày tải lên: 19/02/2014, 16:20

... found that the electrical charge of the b-hairpin loop, as compared with that of other domains of the molecule, might be a key feature for the activity of defensins. It must be noted that the a-helix (residues ... doi:10.1046/j.1432-1033.2003.03657.x However, the 9-mer peptide B, CGGWHRLRC, corres- ponding to the sequence of the MGD1 loop 3 occurring between the two b-strands, had an MIC of 28 l M (i.e. about 2.5% of the activity of the synthetic ... is not possible to infer whether the key role of the b-hairpin loop of MGD1 (loop 3) in antimicrobial activity of MGD1 is of general value in the mechanism of action of defensins. However, our...

Ngày tải lên: 20/02/2014, 11:20

... profound locality (Vu Tu Lap, 1999). The study of altitudinal landscape belts at the Voi Mep massif contributes to the revealing of natural differentiation features of Truong Son range in the ... western part of Quang Tri Province. Characteristics of the Voi Mep massif’s altitudinal belt differentiation 11 2. Topographic features of the Voi Mep massif Voi Mep massif with the highest ... water divide surfaces. On the background of an old weathering crust also emerge granitic blocks of different sizes, rather well eroded, creating a peculiarity of the top surface. Currently...

Ngày tải lên: 05/03/2014, 16:20

... regulates the formation of transport complexes. GTP hydrolysis by Ran in the cytoplasm drives disso- ciation of the export cargo from the export complex, whereas RanGTP promotes disassembly of the ... the activation of nuclear protein export in myotubes. It is highly possible that a selective increase in the efficiency of nuclear protein export triggers the redistri- bution of a number of key ... myoblasts and myotubes (Fig. 2E), indicating that the composition of the myoblast NPC must differ from that of the myo- tube NPC. Specifically, the number of Nup358 pro- teins within individual NPCs...

Ngày tải lên: 06/03/2014, 01:20

... released with the same solution in the presence of 250 mm imidaz- ole. The protein concentration of the samples was deter- mined by a previously established method [42]. The quality of the proteins ... together, these data confirm the specificity of the SenR-binding sites and corroborate the assumption that phosphorylation of SenR by SenSP alters its DNA-binding characteristics. Discussion The designed ... GACGGAATTCAGGATCGGTTCCGG (located upstream of hbpS and ending at the 5 ¢-end of the inverted repeat) H REcofor GCTCGAATTCCGTCCCGTCGCCGG (located upstream of hbpS and beginning at the 3¢-end of the inverted repeat) IIPstrev...

Ngày tải lên: 07/03/2014, 10:20

... present case. The analysis of the kinetic constants of the 4-substituted benzoylformates as substrates for EcIPDC demonstrates that the dependence of the logarithm of k cat /k cat 0 vs. the substituent ... mechanism of cofactor binding as Fig. 6. Progress curves of the reconstitution of EcIPDC with ThDP measured by restoration of the catalytic activity of the formed holo- enzyme for the substrate ... from the rhizosphere of cucumbers, produces large amounts of indole-3-acetic acid. Indolepyruvate decarboxylase, the key enzyme in the biosynthetic pathway of indole-3-acetic acid, catalyses the formation...

Ngày tải lên: 08/03/2014, 02:20

Ngày tải lên: 14/03/2014, 13:20

... imperfect processivity are often cited as causes of the slowdown [14,29,30]. One of the most controversial theories concerns the influence of crystallinity and the change of the degree of crystallinity ... for this slowdown of the reaction rate but, so far, no mechanistic explanation of the slowdown has been validated. The substrate characteristics often implied in the slowdown of the reaction rate include ... f j is the contribution of PASC to the spectrum and e is the random error. ^ f j ,the least square estimate of f j , was used to estimate the crystallinity by multiplying the contribution of Avicel ð1...

Ngày tải lên: 15/03/2014, 10:20

... making the management of the disease easier. Median value of PCI of family of the patients was Rs. 400 and mean value was Rs. 543 with a range of Rs. 100 - 2500. The mean PCI of family of the ... neoplasia. Among the patients with history of multiple sexual partners of their husbands, 94.4% patients and among the patients with history of STD syndrome of their husbands, all the patients ... According to the health report from Hong Kong (Department of Health, Government of the Hong Kong Special Administrative Region, 2004), while reporting on the role of the male in the causation of cervical...

Ngày tải lên: 22/03/2014, 11:20

... subsequent to the stress response, to the adjustment of the nuclei number to the volume of the atrophying fibers, or is a direct consequence of the lack of calpain 3 activity on the NF-jB ⁄ IjBa ... dissociation from the catalytic subunit is part of the activation pro- cess of the ubiquitous calpains [19,20]. Therefore, the interesting observation of calpain 3 dimerization raises the question of whether ... to understanding the pathogenesis of the disease. The numerous patients who present two null mutations leading to the absence of the protein together with the recessive pattern of inheritance clearly...

Ngày tải lên: 23/03/2014, 10:21

... study, the validity of the diagnostic methods for the tuberculosis is compatible with the literature. These methods in the diagnosis of tuberculosis are still valid. The minor diversity of the ... diagnostic methods for the tuberculosis are compatible with the literature. These methods in the diagnosis of tuberculosis are still valid. We think our study may add to the current data in the literature ... December, 2009,). METHODS Eighty-one people who were suspected to have tuberculosis were included in the study. The validity of the applied methods for the diagnosis of tuberculosis tuberculin...

Ngày tải lên: 29/03/2014, 03:20

... filters across the inputs degrades the performance of the amplifier. This practice loads the input of the amplifier, which substantially lowers input impedance and degrades the CMRR of the differential ... 100 times that of the high- est spectral component of the signal, the optimal value of the sampling capacitor would result in the picofarad range to present an input impedance in the gigaohm range. 36 ... period of time and then drifts back to the original baseline. The time required for the return of normal operational conditions of the biopotential amplifier after the end of the saturating stimulus...

Ngày tải lên: 29/03/2014, 11:20

... subject to the requirements of the AIFMD. There are no provisions in the AIFMD which impose con- ditions or criteria on the AIF for the appointment or selection of the AIFM. Therefore, the AIF is ... in the application of the AIFMD, and to ensure uniform conditions of application of the AIFMD. 2. The different types of AIFM will manage a variety of AIF legal structures and a variety of ... determine types of AIFM, where relevant in the application of the AIFMD, and to ensure uniform conditions of application of the AIFMD. Contents Definition of AIFM This section of the discussion...

Ngày tải lên: 30/03/2014, 14:20

Ngày tải lên: 30/03/2014, 20:20

Ngày tải lên: 18/06/2014, 18:20

Ngày tải lên: 18/06/2014, 19:20

Ngày tải lên: 19/06/2014, 08:20

Ngày tải lên: 20/06/2014, 07:20