... than lines of type with 4–6 words each will cause the audience to strain to read and miss what you are saying Match your visual aids to the scale of your audience and always strive for readability ... quality of your materials Be ready to handle equipment malfunctions and unexpected distractions Respect the audience Assume they are as interested in the subject as you are Speak plainly and avoid ... overheads, they offer an outline, key ideas and words they can’t provide much detail Photographic images can leave a memorable impression A drawback is that slides require a dark room, which causes...
... some avascular areas, mild disorganization of the capillary architecture and absent or some ramified capillaries Finally, the late pattern criteria were irregular enlargement of capillaries, few ... few or absent giant capillaries, absence of hemorrhages, severe loss of capillaries with large avascular areas, severe disorganization of the normal capillary distribution and frequent ramified/ ... inhibition of angiostatic factors rather than a further increase of VEGF Angiostatic factors are often cleaved enzymatically from extracellular matrix proteins [40] Among these extracellular matrixderived...
... doi:10.1186/ar3442 Cite this article as: Innala et al.: Cardiovascular events in early RA area result of inflammatory burden and traditional risk factors: a five year prospective study Arthritis Research ... (20.6)*** VAS pain (mm) Table Cardiovascular risk factors and treatment in early RA at baseline (T0) and after five years (T5) 1,2 AUC DAS28 (6 mo) AUC DAS28 (12 mo)1,2 1,2 AUC DAS28 (24 mo) Extra-articular ... radiography, electrocardiography, and laboratory changes resulted in full time warfarin treatment The information regarding fatal cardiovascular events was obtained from the National Board of...
... 271:20438-20443 Kamata T, Tieu KK, Irie A, Springer TA, Takada Y: Amino acid residues in the alpha IIb subunit that are critical for ligand binding to integrin alpha IIbbeta are clustered in the betapropeller ... domain of urokinase-type plasminogen activator (uPA) and integrin alpha v beta induces signal transduction and enhances plasminogen activation Thromb Haemost 2006, 95:524-534 31 Tarui T, Mazar AP, ... example, the focal adhesion kinase/cSrc, and the small GTPases Ras and Rho) and adaptors (for example, Cas/Crk and paxillin) that assemble within dynamic adhesion structures, including focal adhesions...
... poll your audience, or break into smaller groups to an activity Practice a Lot The most important thing you can do, above all other suggestions, is to practice, practice, practice Malcom Gladwell ... voice means you are asking a question; ending your sentence slightly lower indicates authority The biggest mistake most speakers make is a failure to slow down or use pauses Silence and space between ... your presentation is, your audience hasa limited attention span Find opportunities to make the presentation entertaining and interactive You can field questions, use technology like TextTheMob to...
... 320–330 Yashar Mehdad, Matteo Negri, and Marcello Federico 2011 Using bilingual parallel corpora for crosslingual textual entailment In Proc of ACL-11, pages 1336–1345 Rada Mihalcea, Ravi Sinha, and ... lines of Navigli and Lapata (2010) At its core, the API leverages an in-house Java library to query paths and create semantic graphs with BabelNet The latter works by pre-computing 69 off-line paths ... WSD approach to multilingual lexical substitution, tasks and SemEval 2010 In Proc of SemEval-2010, pages 129–133 Mitesh M Khapra, Salil Joshi, Arindam Chatterjee, and Pushpak Bhattacharyya 2011...
... CPB2.8 has Asn60, Asp61 and Asp64 whereas CPB3 has Asp60, Asn61 and Ser64 Interestingly, CPB18, which also has Asp60, Asn61 and Ser64 but also Tyr84 and Asn18 instead of the His84 and Asp18 in ... pGL40: 5¢-GACGCCGGTGA AGAATCAGGGTGCGTG-3¢, OL418 to generate pGL41: 5¢-CGAACGGGCACCTGTACACGGAGGACAGC-3¢ and OL420 to generate pGL42: 5¢-GCTGCGATGACA TGAACGATGGTTGCGACGGCGGGCTGATGC-3¢ These mutant constructs ... applied to lanes 1–7 as denoted for (A) Molecular mass markers are shown in kDa The antiCPB serum recognized CPB isoenzymes that migrated as a major band with a molecular mass of 27 kDa and a...
... lượng ch a đủ mong muốn” Còn Afew mang ý ngh a tích cực , “một lượng gần đủ rồi” Xét ví dụ: Few people came to my birthday party (1) Afew people came to my birthday party (2) Câu (1) mang sắc ... ta chắn khơng “nhiều” Ta nói “I have some Facebook accounts” chẳng hạn Several: Chỉ số lượng “nhiều Some, Many“ Đơi ta dùng “some” several thay thể cho Many: Rõ ràng ta gặp khó khăn với Many, ... Trong Tiếng Anh, có nhiều trường hợp phải mơ tả số lượng BAO NHIÊU “how much”, “how many” Khi ta nói : “I have friends”, “She has books”, dường ý câu ch a thực trọn vẹn Người ta thường diễn...
... that the word storm in (2) has had a lot of transfers in their root meanings - Examine the metaphoric meaningsof words denoting weather - Analyze and make a comparison of metaphoric meaningsof ... defined as the state of being fairly cold, not hot or warm Below are the metaphoric meaningsof cool 4.4.1.1 Pleasantly cool giving out at a fairly temperature in a way that is pleasant, rather ... Disagreeing 4.5.2.7 Disappear 4.5.2.8 Sexy There are twelve metaphoric meaningsof CLOUD both in 4.5.1.2 Sad, anxious, afraid English and Vietnamese Five ofthemare similar in both languages...
... lack of positive charge, maintains the polar character and the possibility of donating H-bonds In the Y111N variant, the aromatic ring is replaced by a group which is also structurally planar ... side facing the membrane is dramatically changed (Fig 4) Finally, as 15N NMR relaxation can be used to characterize the dynamic properties ofa protein in solution, relaxation data were obtained ... compilation ª 2011 FEBS M A Pardo-Cea et al Structure of R29Q and Y111N StnII mutants Table NMR structural calculations summary and statistics StnII-R29Q Calculation Distance restraints Angular...
... being cleaved off with a half-life of 60 Cleavage resulted in a predominant peak of 4047 Da Intact NPY had an average observed molecular mass of 4265 Da NPY was an efficient substrate of FAP, with ... incubation of GIP in buffer alone is also shown (G) Representative MALDI-TOF MS analyses of substrate at early (A, D), middle (B, E) and late (C, F) stages of cleavage are shown Peaks are labelled ... Journal compilation ª 2011 FEBS 1329 Substrates of fibroblast activation protein F M Keane et al Council N A Nadvi and T.-W Yao each hold an Australian Postgraduate Award This research has been facilitated...
... thanks, Miami; thanks, Mom; thanks, Dad PART Brand Strategy: Finding Your Self-Brand Idea CHAPTER Take Charge of Your Self-Brand And say to all the world, “This was a man.” William Shakespeare ... persistence does pay off One ad agency interpreted my background as “creative,” and I had a foot in the door The mark ofa hot ad shop was big-name national accounts and talked-about TV campaigns Trout ... you had in mind You Area Brand! will make the principles of branding available to you In many ways, brands are like people: They have qualities, attributes, and personalities And people are like...
... estimates of earnings changes attributable to activation derived from administrative data by year activated, activation duration, pay grade, and military occupation There are numerous examples where ... different answers Any estimate of tax advantage from the survey would be problematic and not exactly comparable to the estimate from the administrative data Adding a flawed estimate of the tax advantage ... Estimates of Average Monthly Earnings Change Derived from SOFS-R and Administrative Data, Excluding the Tax Advantage (in dollars) SOFS-R Administrative Data SOFS-R Minus Administrative Data %...
... 5¢-CGAGA GGTGGCGCAGCAGTTCAACCAGACAGTCCAG-3¢ (forward), 5¢-GCCGCTCTAGATTAGCGCACTC-3¢ (reverse); HNF1aaains26: 5¢-CGAGAGGTGGCGCAGCA GTTCAACCAGACAGTCCAG-3¢ (forward), 5¢-CTCC CTGCCCTGCATGGGTGAACTCTGGAAAGAGAA ... made with the following primers HNF1aaa: 5¢-CGGAATTCAATGG TTTCTAAACTGAGCC-3¢ (forward), 5¢-CGCGGATCC CCGAGTCTCCCCC-3¢ (reverse); 5¢-CGCGGATCCGA GGACGAGACGG-3¢ (forward), 5¢-GCTCTAGATTA GCGCACACCGTGGAC-3¢ ... CTGCCCTGCATGGGTGAACTCTGGAAAGAGAA AC-3¢ (reverse) HNF1aabH and HNF1aabHS were generated by replacing the BamHI-XbaI fragment of HNF1aab with the BamHI-XbaI fragment ofa PCR product generated using the...
... The Annals of Mathematical Statistics, 22(1):79–86, March Peter Turney and Michael L Littman 2003 Measuring praise and criticism: Inference of semantic orientation from association ACM Transactions ... 2003; Riloff and Wiebe, 2003), and discriminating between positive and negative language (Turney and Littman, 2003; Pang et al., 2002; Dave et al., 2003; Nasukawa and Yi, 2003; Morinaga et al., 2002) ... the same Here (ACQ, ACQ) is close to but not exactly zero because they are different samples of documents in the ACQ category Since the CIs of Monte Carlo estimates are reasonably tight, we assume...
... and usually they disclose the fact that the author had no idea in regard to the real nature of the problem or the meaning ofa mathematical proof In afew cases the authors were fully aware of ... the ease with which the skilful mathematics teachers often cleared away what appeared to be great difficulties to the students have filled many with a kind of awe for unusual mathematical ability ... UNKNOWNS IN MATHEMATICS It may be of interest to note in this connection that a mathematical proof implies a marshalling of mathematical results, or accepted assumptions, in such a manner that the...
... rain of heavy stones, too close in for the use of bows There was only the sword against armor, like the sound ofa thousand hammers against a thousand anvils "Stand fast! Stand fast! Hold them off!" ... George and England!" The Hospitallers, taking heart at the charge, were going in! Behind them came the Count of Champagne, the Earl of Leister, and the Bishop of Beauvais, who carried a great warhammer ... us, there are uncounted Turks to the fore, and if, as we are aware, our rear is being dogged by the Bedouin and the black horsemen of Egypt, it would seem that Saladin has at hand more than enough...