... suspense was broken by the appearance nearly a half a mile away, of a soldier with something white on his back, that made a good target for the rebel sharpshooters Down the railroad I came I reached ... readers and comrades, that no matter what he had done, or what mistakes he had made, his memory will always find a warm spot in the heart of that little Drummer Boy from Maine One day, soon after ... make out About a mile ahead of us lay a United States gunboat, and every few minutes a puff of smoke, and then a loud bang erang erang erang with its long vibrations on that still morning, awoke...
Ngày tải lên: 17/03/2014, 02:20
... people in a criminal gang, a 22-year-old raped by a man and later forced to marry him, and a 16-year-old raped by a 45-year old man in order to force her to marry him), and a 21-year-old female reportedly ... voluntarily) • Abduction: Being forcibly taken or disappearing from a home or village • Sexual Abuse: Unwanted verbal harassment or attempts at touching; unwanted sexual advances such as kissing, ... Published: March 2011 References Shana Swiss M, Peggy J, Jennings P, Gladys V, Aryee R, Grace H, Brown C, Ruth M, Jappah-Samukai B, Mary S, Kamara R, Rosana DH, Schaack R, Rojatu S, Turay-Kanneh R:...
Ngày tải lên: 13/08/2014, 15:21
LESSONS LEARNED FROM DRINKING JUST A CAN OF BEER - 08/02/2011
... thức cho: khác a thức 0) A A:N = B B: N (N nhân tử chung) A A.M (M a thức khác a thức 0) = B B.M Nếu chia tử mẫu phân thức cho nhân tử chung chúng phând) phân thức thức cho: A A:N = B B : N ... C A PHÂN THỨC Tính chất phân thức, giải thích có phân thức thể viết: A A.M = A - A 2x(x - 1) 2x B B.M a) = ; b) = (x + 1)(x - 1) x + B - B (M a thức §2 TÍNH CHẤT CƠ BẢN khác a thức 0) A A:N ... dấu A - A = B - B A - A = B - B §2 TÍNH CHẤT CƠ BẢN ?5 Dùng quy tắc đổi dấu C A PHÂN THỨC Tính chất điền a thức thích hợp vào phân thức chổ trống đẳng thức A A.M sau :y - x x - y = B B.M a) =...
Ngày tải lên: 19/10/2014, 04:00
A Happy Boy
... begins again, and you are going with me up to the gard." Oyvind had heard that school was a place where many boys played together, and he had nothing against that He was greatly pleased; he had often ... She sat tearing up the grass with her hands, and said, "I was not allowed to keep it; grandfather is up there waiting." While the boy stood staring at her, a sharp voice from the road above called, ... alone on the roof, and, could get no higher Then something wet was thrust right against his ear, and he started up "Ba -a- a -a! " he heard, and it was the goat that had returned to him "What! have...
Ngày tải lên: 06/11/2012, 16:13
A Substance Isolated from Cornus officinalis Enhances the Motility of Human Sperm.pdf
Ngày tải lên: 16/12/2012, 15:24
A COUNTRY OF SCENIC WONDERS.
... are arranged in a zigzag pattern, like the figure splashing in the water Many islands are named after the figures that they resemble, such as Frog, Elephant, Fighting Cock… Ha Long is a great ... great attraction to tourists because it is sublime, beautiful and picturesque The scenery in Ha Long can never be boring Do Son Beach Another popular place is Do Son, an area that has many beaches ... Ha Long Bay Ha Long Bay is well-know beauty spot in the North-East sea of Vietnam, in Quang Ninh province, 151 kilometers east of Hanoi Ha Long Bay is numerous islands and mountain of different...
Ngày tải lên: 05/07/2013, 01:27
Tài liệu Retrieving a Single Value from a Query pdf
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
Ngày tải lên: 14/12/2013, 18:16
Tài liệu Pass a Dataset Back from an XML Web Service docx
... columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because the ... - - - ... username once again The first table from the returned dataset is assigned to the DataSource property of dgUsers Listing 13.6 frmHowTo13_4.vb: Retrieving a Dataset from a Web Service Private Sub btnLogin_Click(ByVal...
Ngày tải lên: 24/12/2013, 06:17
Tài liệu Figure Drawing Without A Model - Drawing from Life pptx
Ngày tải lên: 21/01/2014, 08:20
Tài liệu Getting a Sequence Value from Oracle pdf
... creating the sequence Oracle stores the definition of sequences for a database in a single data dictionary table in the SYSTEM table namespace As a result, all sequence definitions are always available ... CommandType.StoredProcedure; // Add the parameters and set values for them cmd.Parameters.Add(ID_PARM, OracleType.Int32).Direction = ParameterDirection.Output; cmd.Parameters.Add(FIELD1_PARM, OracleType.NVarChar, 50); ... generate a sequence of unique values for a primary key column, but is not related to the table containing the column As a result, a sequence generator can generate unique values for more than one...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Voices of Fear and Safety¿ Women¿s ambivalence towards breast cancer and breast health: a qualitative study from Jordan pdf
... “Voices of Fear and Safety” Women’s ambivalence towards breast cancer and breast health: a qualitative study from Jordan Hana Taha1,2,3* Email: hana.taha@ki.se Raeda Al-Qutob4,5 Email: raeda@johud.org.jo ... Foundation, Amman, Jordan Abstract Background Breast cancer is the leading cause of cancer mortality among Jordanian women Breast malignancies are detected at late stages as a result of deferred breast ... moderated by the PI in Arabic Each lasted about 50–60 minutes The FGDs were all audio-taped and an Arabic speaking research assistant attended to observe and take notes The tape recorded data from...
Ngày tải lên: 13/02/2014, 06:20
Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It
... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... of my MFA work—papers, analysis, presentation—but college was an arena to develop other skills like leadership/team management and being a team player I argue that amazing games are near impossible ... games are still alive Some are still making games They have pioneered a great many genres, mastered programming algorithms and design patterns, and have learned to adapt to platform after platform...
Ngày tải lên: 13/02/2014, 17:23
Tài liệu Just a Job? Communication, Ethics, and Professional Life pptx
... college debate coach, and a bookseller at a large chain, Dan took a job as a marketing representative in the employee assistance program division of a regional managed-care corporation Dan had never ... communicate about ethics across several domains Chapter addresses work as an important domain of ethical talk The chapter argues that work and the talk about it are unavoidably ethical in nature and ... such a proclamation is a lot like saying, “We have to the rational thing, and that is [my proposal].” Here we find both an emotional and a rational one-upmanship that can slide into a threat, as...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases, ... Conard J, Brosstad F, Lie Larsen M, Samama M & Abildgaard U (1983) Molar antithrombin concentration in normal human plasma Haemostasis 13, 363– 368 Skinner R, Abrahams JP, Whisstock JC, Lesk AM,...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... somewhat smaller on average than those in extracts from Artemia, and by way of comparison, small heat shock /a- crystallin proteins produced in transformed bacteria usually reside as oligomers similar...
Ngày tải lên: 22/02/2014, 04:20
Social Marketing: A Resource Guide from the Social Marketing National Excellence Collaborative doc
... for assessment, design and late market penetration Feedback from target audiences was anecdotal Gatekeepers and health care professionals for the most part approved and helped distribute information ... outline a social marketing approach aimed at changing behaviors among your target audience Facilitators will be available during this workshop to answer questions Each group should appoint a spokesperson ... These are the five foundations that support it They all need to be in place We can use the “P”s as a way to recognize and balance weaknesses in our programs (For example, you may have caring staff...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal model of septic ... IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ± SD The significance of the results was assessed ... proinflammatory effects of fragments generated from extracellular matrix degradation by elastase are well documented For example, degradation products of elastin or heparan sulfate proteoglycan can...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt
... bound Covalent flavinylation was accompanied by an increase in oxidase activity and formation of hydrogen peroxide This confirms a mechanism of autocatalytic covalent flavinylation in which a reduced ... dehydrogenase, 36 kDa; carbonic anhydrase, 29 kDa; soybean trypsin inhibitor, 20 kDa; a- lactalbumin, 14.2 kDa; aprotinin, 6.5 kDa) Lane 2a: protein-stained cell-free extract Lane 3a: protein-stained cell-free ... primers: forward, 5¢-CACCATATGACG CGAACCCTTCCCCCA-3¢ (NdeI site is underlined); and reverse, 5¢-CACAAGCTTCAGAGGTTTTGGCCACGG-3¢ (HindIII site is underlined) After amplification, the DNA was digested...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khóa học: Localization, purification and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot
... These data indicated that the fractionation procedure was satisfactory and that the tetrathionate hydrolase is a periplasmic enzyme Purification of the tetrathionate hydrolase from tetrathionate-grown ... hydrolase activity was located to the soluble fraction Further fractionation to the periplasmic, cytoplasmic, and membrane fractions revealed that tetrathionate hydrolase (96%) and acid phosphatase ... was a homodimer with a molecular mass of 103 kDa as determined with MALDI-TOF MS Except for tetrathionate hydrolase from A ferrooxidans strain Funis-2 [20] all other tetrahionate hydrolases have...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt
... Actinobacteria Aquificae Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria ... Siphonosoma cumanense Protein Seq Data Anal 3, 141–147 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain of hemerythrin from Lingula unguis Protein Seq Data Anal ... termophilum Aquifex aeolicus Magnetospirillum gryphiswaldense Burkholderia mallei Burkholderia pseudomallei Janthinobacterium sp J3 Ralstonia solanacearum Pseudomonas aeruginosa Pseudomonas resinovorans...
Ngày tải lên: 07/03/2014, 17:20