jayachandran should corporate political lobbying come under scanner by regulatory mechanism vaishnavi corporate communication and 2g spectrum scam a political lobbying case
(Advances in marketing, customer relationship management, and e services) vimi jham, sandeep puri cases on consumer centric marketing management IGI global (2013)
Ngày tải lên :
16/09/2015, 13:56
... Lobbying Come under Scanner by Regulatory Mechanism? Vaishnavi Corporate Communication and 2G Spectrum Scam: A Political Lobbying Case 230 S Jayachandran, IIT Madras, India This case is about ... under Scanner by Regulatory Mechanism? Vaishnavi Corporate Communication and 2G Spectrum Scam: A Political Lobbying Case 230 S Jayachandran, IIT Madras, India Chapter 20 Tata GoldPlus: Adoption ... Should Corporate Political Lobbying Come under Scanner by Regulatory Mechanism? Vaishnavi Corporate Communication and 2G Spectrum Scam: A Political Lobbying Case raises four criticasl points for...
- 376
- 1.3K
- 0
Oberon's Gift--A Political Fantasy
Ngày tải lên :
07/11/2012, 09:09
... GIFT -a Political Fantasy by Richard Hardaway PREFACE To counteract the gloom and doom of the daily news here‟s an upbeat alternative: Blessed with a wee bit of magic and his own considerable abilities, ... ams who was sucking and smacking at her breast The soft light from the lamp fell across the bed and Lydia appeared to him like a vision; like a madonna in an old painting, all white and pure ... she gave his cheek a tweak He flinched slightly and she reached up and kissed him tenderly Oberon the Good Fairy, watched all this impatiently At length he waved his wand again, and with that,...
- 11
- 281
- 0
Tài liệu Alumni Example Resumes (B.A. Communication B.S. Marketing MBA – Operations MBA - Consulting ) pptx
Ngày tải lên :
20/02/2014, 11:20
... conducted presentations and daily site tours and executed RFP’s and sales contracts Implemented internal team plan to update and maintain company-wide shared files, and standard operating procedures ... $2.5M annual budget while leading team of 15 employees Created and managed all advertising and promotions in accordance with development of marketing plan Tracked and forecasted all sales and ... and management, and facility maintenance and daily operations Prepared operational budget and new coding system for event and operational expenses and revenue EXEMPLA SAINT JOSEPH HOSPITAL –...
- 9
- 337
- 0
“Marketing is the whole business, taken from the customer’s point of view.” - Peter Drucker docx
Ngày tải lên :
06/03/2014, 21:20
... areas • Accessible for the elderly • Tasty breakfast with a place to sit, eat and talk •Clean, accessible restrooms Signs and Banners Create a Vibrant Market Experience The goal is to draw as many ... Kansas Rural Center is a private, nonprofit organization that promotes the long-term health of the land and its people through education, research and advocacy The Kansas Rural Center cultivates ... in and the media will take notice The market can be an asset to the press, as well By creating a media packet (see page 5) and building relationships with reporters, the market can save the day...
- 6
- 431
- 0
How to Write a Marketing PlanThe Marketing Plan is a highly detailed, heavily researched pdf
Ngày tải lên :
22/03/2014, 14:20
... threats Part 2: Situational Analysis Financial Analysis for Product or Product Line Much of this information can be handled within a graphical format, such as tables and graphs, though a paragraph ... Analysis) so readers of the plan can easily compare what was planned to what is planned Part 4: Tactical Marketing Programs Target Market Issues If the target market remains the same as what was identified ... by volume and growth percentage o by segments Channel sales o by volume and growth percentage o by channel Margins Profitability Ratios o use common financial ratios and other metrics associated...
- 20
- 368
- 0
A Portrait of Today’s Smartphone User pptx
Ngày tải lên :
23/03/2014, 03:20
... international clients Background: Methodology • OPA collaborated with Frank N Magid Associates, Inc for data analysis and insight The Magid Media Futures study evaluates attitudes and behaviors ... 12% Made a purchase on a PC 12% Made purchase at a store 12% Researched brand on a search engine 15% 21% 17% 12% Gone to brand website Gone to a brand Facebook page 10% Made a purchase on a mobile ... purchase at a store 12% Researched brand on a search engine 12% Gone to brand website 11% 31% 12% Made a purchase on a PC Gone to a brand Facebook page 30% 27% 24% 24% 10% Made a purchase on a mobile...
- 38
- 339
- 0
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
Ngày tải lên :
23/03/2014, 12:20
... primer, 5¢-CGATCCAAGCTTTAAGGAGG AAtagGAAATGGAATTCATCGAAAAAATCCG-3¢ antisense primer, 5¢-TGCATCCATCTAGAGCATTCA GC-3¢ The amplified PCR product was digested with HindIII and XbaI, separated by agarose ... sulfate fractionation and DEAE-Toyopearl and ButylToyopearl column chromatographies (Table 2) The final Fig SDS/PAGE of LaaA Lane 1, molecular mass standards [phosphorylase b (94 kDa), BSA (67 kDa), ... ethylenediaminetetraacetic acid and o-phenanthroline and/ or activated by divalent cations (Table 4) Comparison of the characteristics of LaaA with those of the other L-amino acid amidases suggests that LaaA is...
- 11
- 283
- 0
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
Ngày tải lên :
30/03/2014, 08:20
... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG ... GTGTGGCAGGACGCTGCGCCTTTCACAG F: CTGTGAAAGGCGCAGCGTCCTGCCACAC S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S: GCCTCTTTAGAAGATCAAAAGTAGG ... External S: GAGACTGGATAGGCTTGTAG External F: GCGCCGAGGACCCCG Internal S: ACAAAGACCTGGTAACTCA Internal F: GAACCTTACTCCACAATTAG S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGG F: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG...
- 16
- 363
- 0
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot
Ngày tải lên :
31/03/2014, 08:20
... CTCACCGGTATACCGCCGGCGCGAG-3¢, at position 1251, 5¢-NotI/NheI (5¢–GCTCGCGGCCGCAGCTAGCA AACCGGAACGTTCAGG-3¢), at position 1277, and 3¢-EcoRI (5¢-TACGACGAATTCGGCCAGATCAAG GC-3¢), at position 1359 over the area to be ... amino acid sequence for the interaction between ExoS and 14-3-3 in vivo We have shown earlier that Ras (and its deactivation of downstream targets such as Erk and PKB/Akt), and many other small ... r, e, g and c) using a BiometraTM slot blot apparatus A summary of these antisera is shown in Table and [41] (A) Whole HeLa cell lysate HeLa cell lysates were subjected to a nity precipitation...
- 9
- 394
- 0
báo cáo hóa học: " Vascular consequences of passive Aβ immunization for Alzheimer''''s disease. Is avoidance of "malactivation" of microglia enough?" docx
Ngày tải lên :
19/06/2014, 22:20
... inflammatory mechanisms to both A clearance and vascular pathology illustrate a somewhat unique example of microglial ambivalence While many had argued that microglial "activation" by A was at ... triggered by anti -A antibodies Furthermore, the investigators also found that the CAA was accompanied by an increase in hemorrhages – similar to a previous report [19] – and a vascular accumulation ... with the majority of advanced cases of CAA [17] Wilcock et al [18] have now produced evidence that the appearance of CAA after immunization may represent an actual increase in this parameter triggered...
- 4
- 240
- 0
báo cáo hóa học:" AIDS-associated Kaposi’s sarcoma is linked to advanced disease and high mortality in a primary care HIV programme in South Africa" pdf
Ngày tải lên :
20/06/2014, 08:20
... this article as: Chu et al.: AIDS-associated Kaposi’s sarcoma is linked to advanced disease and high mortality in a primary care HIV programme in South Africa Journal of the International AIDS ... early access to both cART and chemotherapy for patients with AIDS-associated KS KS is the most common HIVrelated malignancy and an important contributor to AIDS-related mortality Early diagnosis and ... antiretroviral therapy cART Yes 1.0 No 3.4 KS,Kaposi sarcoma HR, Hazards Ratio cART, combination antiretroviral therapy missed, or early cases may have resolved spontaneously on cART without...
- 5
- 339
- 0
101 Ways to Market Your Business 101 Ways to Market Your Business is a collection of marketing pptx
Ngày tải lên :
28/06/2014, 12:20
... price, packaging, delivery, benefits, quality, performance, features, availability, extras, service, proof and guarantees Join an affiliate programs “Pay per Sale” Exchange articles and content ... Learn sales ideas from reading and studying other business advertising and marketing material Educate yourself with new strategies Form a strategic business alliance that allows you to share knowledge, ... your marketing and advertising into a plan Create a list of daily, weekly and monthly tasks Supply news stories related to you and your product Put this information up on the web and mail shot a...
- 8
- 315
- 0
How to Write a Marketing PlanThe Marketing Plan is a highly detailed, heavily researched docx
Ngày tải lên :
28/06/2014, 12:20
... threats Part 2: Situational Analysis Financial Analysis for Product or Product Line Much of this information can be handled within a graphical format, such as tables and graphs, though a paragraph ... Analysis) so readers of the plan can easily compare what was planned to what is planned Part 4: Tactical Marketing Programs Target Market Issues If the target market remains the same as what was identified ... by volume and growth percentage o by segments Channel sales o by volume and growth percentage o by channel Margins Profitability Ratios o use common financial ratios and other metrics associated...
- 20
- 299
- 0
This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx
Ngày tải lên :
28/06/2014, 17:20
... other And — and that was — that was a fallacious model, it was held by Freddie Mac, Fannie Mae, the U.S Congress, the media, me, (LAUGH) investors, and and home buyers all over So it was— it was ... It's still a great business model I mean, I have to get rated— we have a company called Berkshire Hathaway Assurance We have to get a rating from Standard & Poor's and Moody's BECKY: You have been ... and Poor's or Moody's, I would love to it, but I can't it The— the market demands that I be rated by Standard and Poor's and Moody's BECKY: The market demands it because of the government— laws...
- 7
- 325
- 0
How to Write a Marketing PlanThe Marketing Plan is a highly detailed, heavily researched doc
Ngày tải lên :
28/06/2014, 18:20
... threats Part 2: Situational Analysis Financial Analysis for Product or Product Line Much of this information can be handled within a graphical format, such as tables and graphs, though a paragraph ... Analysis) so readers of the plan can easily compare what was planned to what is planned Part 4: Tactical Marketing Programs Target Market Issues If the target market remains the same as what was identified ... by volume and growth percentage o by segments Channel sales o by volume and growth percentage o by channel Margins Profitability Ratios o use common financial ratios and other metrics associated...
- 20
- 187
- 0
Let''''s face it -- English is a crazy language pps
Ngày tải lên :
12/07/2014, 15:20
... horses, from what is a mohair coat made? A slim chance and a fat chance are the same, as are a caregiver and a caretaker, a bad licking and a good licking, and "What's going on?" and "What's coming ... trails are opposites, why are flammable and inflammable materials, heritable and inheritable property, and passive and impassive people the same? How can valuable objects be less valuable than ... harmful actions, why are shameful and shameless behavior the same and pricey objects less expensive than priceless ones? If appropriate and inappropriate remarks and passable and impassable mountain...
- 6
- 297
- 0
báo cáo khoa học:" Tissue engineering: a challenge of today''''s medicine" potx
Ngày tải lên :
11/08/2014, 23:22
... the demanding, complex and interdisciplinary aspects of tissue engineering has to be approached from new ways We have conceptualised Head & Face Medicine therefore as a thematically broad ranged ... engineering is a vision of Head & Face Medicine We hope this journal will attract basic researchers and clinicians who are involved in investigating and applying tissue engineering in the head and face ... region and will contribute to a gain in scientific information, communication, and collaboration in order to improve the outcome of patient treatments References Stamm T: Head & Face Medicine – a...
- 2
- 191
- 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
Ngày tải lên :
14/08/2014, 20:22
... NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A PCAF-C PDGFRA -A PDGFRA-B PDGFRA-C PKD1 -A PKD2 -A PKD2-B PKD2-C PKD2-D PPARA -A PPARA-B PPARA-C PPARA-D PPARA-E PPARA-F PPARA-H PTEN -A RB1 -A RB1-B RB1CC1 -A ... FOXO 1A- C FOXO 1A- D FOXO 1A- E FOXO 1A- F GAB1 -A HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C ... stable cell lines, and performed luciferase and β-galactosidase assays AS, SW, and NC performed western blots All authors read and approved the final manuscript RNA purification and qRT-PCR analyses...
- 14
- 331
- 0
Social media marketing is dead the way brands use it today
Ngày tải lên :
30/11/2015, 10:36
... hello! Stefanos Karagos Founder & Information Alchemist XPLAIN The Leading Content Marketing Agency Countries more than 100 Brands @karagos xplain.co Who are you? About xplain.co a 365 Agency I ... It’s ALL About
Content Marketing And You NEED
a Serious Content Strategy
if you want your Brand to Have
a Serious Communication Not Just Another FB
or Mobile App Marketers
Have to Understand ... ALL Live In A Recession Brands
are Suffering Consumer Behavior has Changed! Familiar Scene? There is
a Communication Gap Traditional media are going Web = Pure Content Social Web = UGC mostly...
- 78
- 170
- 0