ivf method a conventional oocyte insemination

Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Ngày tải lên : 12/08/2014, 18:20

... Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published: 22 May 1998 References Doebbeling BN, Stanely GL, Sheetz CT, et al: Comparative efficacy of alternative hand-washing ... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing/the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... that of the conventional, alcohol lotion showed significantly higher rates of bacterial removal than that of hand-washing with tap water (52.1 ± 11.3%; P < 0.05) Nosocomial infections are a major...

2
450
0

the finite element method a practical course

Ngày tải lên : 08/04/2014, 10:38

... Physical, mathematical, computational, and operational, economical Simulation Experimental, analytical, and computational Analysis Photography, visual-tape, and computer graphics, visual reality Design ... solids Matrices for linear triangular elements, bilinear rectangular and quadrilateral elements are derived in detail Area and natural coordinates are also introduced in the process Iso-parametric ... publishers British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloguing in Publication Data A catalogue record...

361
416
0

liu quek the finite element method a practical course

Ngày tải lên : 04/06/2014, 13:17

... practical problems and structural analysis and heat transfer Important fundamental and classical theories are introduced in a straightforward and easy to understand fashion Modern, state-of-the-art ... publishers British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloguing in Publication Data A catalogue record ... linear elastic Materials can be anisotropic, meaning that the material property varies with direction Deformation in anisotropic material caused by a force applied in a particular direction may...

365
1.1K
0

báo cáo hóa học:" Reinterpretation of evidence advanced for neo-oogenesis in mammals, in terms of a finite oocyte reserve" pdf

Ngày tải lên : 20/06/2014, 07:20

... In summary, the data of Johnson et al [7] on BU treatment of female mice causing aplasia and ovarian failure are interpretable entirely by cytotoxicity to early and late stage oocytes, and disruption ... incorporation is cytoplasmic, and to DNA recombination and repair where incorporation is nuclear, rather than to replicative nDNA synthesis alone These alternative explanations may be relevant also ... enzymatic capacity for DNA repair pathways [37], and circumstantial evidence for this activity was obtained by Oktay et al [38] from expression of the DNA-repair associated protein, PCNA, in...

20
407
0

Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot

Ngày tải lên : 12/08/2014, 20:21

... ml)d Values are presented as mean ± standard deviation aFrom plasma glucose values using the same glucose analyzer for original IDVG bUsing a conventional glucose analyzer (combined blood gas and ... than automatic regular calibration, the analyzer was not calibrated Plasma glucose concentrations in all blood samples were also measured using amperometry by glucose oxidase immobilized membrane–H2O2 ... blood samples using a conventional glucose analyzer in the ICU is clinically acceptable as an alternative calculation of IDVG, although approximated and original IDVGs are not equivalent Competing...

6
286
0

Báo cáo khoa hoc:" Retroperitoneoscopic radical nephrectomy with a small incision for renal cell carcinoma: Comparison with the conventional method" docx

Ngày tải lên : 11/08/2014, 07:21

... in cases In the latter, pathological tumor stage was T 1a in 25 cases, T1b in cases and larger T2 in cases Histological data and nuclear grade was available In the A method, 84.3% had clear cell ... skin incision Page of 13 Tanaka M, Tokuda N, Koga H, Yokomizo A, Sakamoto N, Naito S: Hand assisted laparoscopic radical nephrectomy for renal carcinoma using a new abdominal wall sealing device ... renal cell carcinoma is T1N0M0 renal cell carcinoma That’s because we thought that laparoscopic approach caused peritoneal adhesion more than retroperitoneoscopic approach In T2-T3aN0M0 renal...

5
248
0

Development of a method to measure consumer emotions associated with foods

Ngày tải lên : 03/04/2013, 21:07

... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... Sensation seeking and positive affect 1.4 Facial scaling Another approach to measuring emotions has been the use of facial scaling A number of different systems for facial scaling have recently appeared...

10
781
3

A Study on the Optimum Backwashing Method applied to Activated Carbon Process in Waterworks

Ngày tải lên : 05/09/2013, 08:40

... characteristics of a granular activated carbon In a granular activated carbon contact basin, virgin carbon is domestic activated carbon made from palm shell, reactivated carbon means activated carbon produced ... granular activated carbon-attached germs was 1.1ⅹ105∼5.8ⅹ108CFU/g, and granular activated carbon proved to be operated by BAC The number of spent carbon-attached, reactivated carbon-attached, and ... The quantity of germs attached to activated carbon A sample was picked by an activated carbon picker inserted, by less than 1m, into the filter layer of a granular activated carbon contact basin...

14
705
0

a rapid method for estiminating of noise expouse workplace

Ngày tải lên : 05/09/2013, 13:23

... Checklist and SPAN in Veterans Affairs primary care settings (16) In this study, the positive predictive value was 25 Golmohammadi R et al: A Rapid Method for… 62.5% and negative predictive value as ... Less than years Quality of maintenance of equipments Suitable Little suitable Unsuitable Rotation and duration of noise produce noise sources All of shift Half of a shift Less than a half shift ... contained grade coefficients 1, and As well as, regarding to the rate of their effect on noise aggravation, for each item a modified constant was considered Determining of these constants was based...

7
418
0

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

Ngày tải lên : 05/09/2013, 16:10

... water is provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation ... if air looses enthalpy, water would be heated Thus, in a process where air and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the adiabatic ... recirculated to maintain its temperature at the adiabatic saturation temperature of inlet air Because the sensible heat load is transferred to the water surface and transformed into evaporation latent...

28
652
0

A capillary-based method determining the permeability of sand layer for geothermal applications

Ngày tải lên : 05/09/2013, 17:03

... provide an important basis for analyzing the heat transfer process of BHEs in a sand-based aquifer, and also be applied for other porous materials with the grain diameter of 0.1-0.6mm Theoretical ... Figure Diagram of the experimental setup measuring the hydraulic permeability of sand layer based on the CR method 3.2 Data treatment The porosity φ was tested according to the national standard Soil ... In nature, this method was also based on the Darcy’s law The tests results showed that this method had a good accuracy and low requirement for the amount of test samples The present method can...

8
449
0

Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

Ngày tải lên : 22/10/2013, 10:15

... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... payable at the address of a 74 third party or in a locality other than that of the domicile of the drawee, or, except in the case of a bill drawn payable at a fixed period after sight, the drawer ... to act The same rule applies to a representative who has exceeded his powers Article The drawer guarantees both acceptance and payment 33 34 He may release himself from guaranteeing acceptanceevery...

37
673
0

A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy

Ngày tải lên : 01/11/2013, 08:20

... pregnancy There was a signiﬁcant further advance of her renal disease, necessitating the initiation of haemodialysis (a kidney machine) two years later, and a living, related donor renal transplant ... remarkably stable The pregnancy was complicated at 20 weeks’ gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation with heparin and warfarin ... renal damage reported a prematurity rate of 17 per cent and a spontaneous abortion rate (miscarriage) of 20 per cent, as compared to 163 164 G.M Lockwood prematurity and spontaneous abortion rates...

6
512
0

Tài liệu Creating a Generic Method pdf

Ngày tải lên : 24/12/2013, 09:16

... BinaryTree; This namespace contains the Tree class Add a method called BuildTree method to the Program class This should be a static method that takes a params array of T elements called data, ... sortTree.Insert(data[i]); } return sortTree; } Test the BuildTree method In the Main method of the Program class, add the following statements that create a new Tree for holding character data, populates ... method These statements instantiate a new Tree object by using the appropriate type parameter, and then iterate through the params list, adding each item to the tree by using the Insert method The...

4
293
0

A monte carlo method for multi area generation system reliability assessment

Ngày tải lên : 03/01/2014, 19:35

... the available area generation capacity and the area load In the supported set, the available area generation capacity is smaller than the area load A "required load" is defined for each area in ... Table UXE Sensitivity Indices of System and Area to Area Generation and Tie Line Capacities i Case (in Whhear/llW) n I l I Area I Area I Area I Area I System Table I l 1 I I I Area I Area Area ... generation system Table UXE Sensitivity Indices of System and Area to Area Generation and Tie Line Capacities i Case (in rwh/year,+w) n I I I I I I Area Area Area Area Spta I I I I I I Area I Area...

6
367
0

A novel interval method for validating state enclosures of the

Ngày tải lên : 12/01/2014, 22:04

... the words validated, guaranteed, and veriﬁed are used interchangeably to denote that state enclosures are mathematically and not only empirically proven to be correct Traditional validated techniques ... ode45s has been used with an equally spaced grid {ti }, ti − ti−1 = 5·10−4 Mean-value rule (MVR) evaluation and advanced interval methods (AIM) have been applied to evaluate the iteration formula ... evaluation and other advanced interval methods such as monotonicity tests and iterative techniques for range calculation In contrast to the VAL E NC IA-IVP solver, VNODE is based on a two stage approach...

12
373
0

Tài liệu The Cost of a Military Person-Year - A Method for Computing Savings from Force Reductions pptx

Ngày tải lên : 17/02/2014, 23:20

... of Program Analysis and Evaluation (PA&E) NOTE: Data are budget estimates, not execution data avoided by this action If a similar calculus can then be performed for an alternative civilian position, ... current military personnel Instead, DoD pays an annual accrual charge into the trust funds These accrual charges are carefully calculated actuarial payments that represent the best estimates of the ... cost of a military person-year is equal to a metric called regular military compensation (RMC) RMC includes average basic pay for each military grade, basic allowance for housing, basic allowance...

153
396
0

Tài liệu Báo cáo khoa học: A facile method for expression and puriﬁcation of the Alzheimer’s disease-associated amyloid b-peptide pdf

Ngày tải lên : 18/02/2014, 13:20

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...

16
691
0

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20

... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... Minneapolis, MN, USA), anti-Prox-1 (Acris Antibodies, Hiddenhausen, Germany), and anti-SV40 T Ag (Santa Cruz Biotechnology, Santa Cruz, CA, USA) The corresponding secondary antibodies labeled...

11
873
0