isolate a nonadjustable pressure relief valve malfunction

... designated rated lift - the design lift at which a valve attains its rated relieving capacity seat angle - the angle between the axis of a valve and the seating surface A flat-seated valve has a ... Romanian Pressure Vessel Standard Japanese Industrial Standard Committee Japanese Standards Association 1-24, Akasaka 4-chome, Minato-ku Tokyo 107 Japan JIS B8210 Spring Loaded Safety Valves for Steam ... Systems API Standard 526 Flanged Steel Safety Relief Valves API Standard 527 Commercial Seat Tightness of Safety Relief Valves with Metal to Metal Seats API Standard 2000 Venting Atmospheric and...

Ngày tải lên: 02/04/2014, 16:21

... ta hay sử dụng valve valve thường đóng NC để làm thay đổi áp suất làm việc hai nhánh làm việc khác Tức có áp suất chênh hai nhánh làm việc hệ thống gây valve Khác với valve an toàn, c a dầu valve ... dụng ví dụ cần lắp valve giảm áp vào trước xy lanh A để đ a nguồn 50 bar cho mục đích kẹp Valve phân phối tỷ lệ Valve phân phối tỷ lệ: Valve chia làm ba phần: 1- Phần thân vỏ valve với lõi trượt ... suốt c a van cho dòng chảy qua Vị trí van điều chỉnh việc vặn tay quay Khi vặn tay quay góc 90o ta có van vị trí đóng mở hoàn toàn Nếu so sánh với van c a loại van có độ đóng mở nhanh Tay quay đầu...

Ngày tải lên: 08/01/2014, 01:45

... working pressure discharge area – see actual discharge area effective discharge area – a nominal or computed area of flow through a pressure relief valve, contrasted to actual discharge area For ... that has an area equal to or greater than A (4) Select a “P” orifice with an actual area equal to 6.38 in2 EXAMPLE (Gas/Vapor Application)(see Table on the next page) Given: Fluid: Required Capacity: ... subdivisions, parts, subsections, and mandatory and non-mandatory appendices The ASME Code Symbol Stamp and the letters “UV” on a pressure relief valve indicate that the valve has been manufactured in accordance...

Ngày tải lên: 11/01/2014, 15:10

... Cushions/mattresses/overlays that contain a combination of pressure relieving materials are usually arranged to provide a degree of stability to the seating base The combination of different materials may have the advantage ... provided A material such as platilon may be used as it is both waterproof and water permeable, i.e moist air can circulate through it repairs, or has a carer who could help If there is no one available ... beds may be available as well as manual handling equipment such as hoists and slide sheets Employment service Range of equipment available Standard off-the-shelf cushions and individualised made-to-measure...

Ngày tải lên: 08/03/2014, 19:20

... high -pressure stoppedflow study on P450cam by a homologous series of camphor analogues (1R-camphor, camphane, norcamphor and norbonane) and substrate-free protein These camphor analogues lack characteristic ... activation entropy in substrate-free P450cam may indicate that the CO molecule travels along many pathways to the heme iron Along each pathway, however, many contacts (e.g contacts to many water ... simplest approximation we used a linear combination of two bimolecular processes to fit the curves At bar the fractions of the slow and the fast phases are approximately equal For the camphane complex...

Ngày tải lên: 08/03/2014, 23:20

... spoofing of an activation signal forces sensors to emit packets and facilitates tracking and battery drain attacks Although activation signals are very simple, they can convey a minimal amount of ... even without easy access to transceivers that operate at the target frequency band 6.2 Improving Data Packet Format One fundamental reason that eavesdropping and spoofing attacks are feasible in ... incoming activation signal and wakes up the sensor only when a matching signal is recognized Activation signals are mainly used by car dealers to install and diagnose tire sensors, and are manufacturer-specific...

Ngày tải lên: 23/03/2014, 10:20

... of the manuscript All authors have read and approved the final manuscript Additional material Additional file Characteristics of the customised and prefabricated orthoses The data compare the ... plantar pressure and pain in rheumatoid arthritis Clin Biomech (Bristol, Avon) 1999, 14(8):567-575 Li CY, Imaishi K, Shiba N, Tagawa Y, Maeda T, Matsuo S, Goto T, Yamanaka K: Biomechanical evaluation ... metatarsophalangeal joints), and hallux Data from the lateral digits yielded low values with high variance Because of the potential for error and limited importance of the lateral digit mask area,...

Ngày tải lên: 10/08/2014, 21:23

... Disease Hospital, Al-Jabriah, Kuwait Department of Cardiac Anaesthesia, Chest Disease Hospital, Al-Jabriah, Kuwait Authors’ contributions NAS wrote the initial manuscript FAS and JAF were major contributors ... journal Al-Sarraf et al Journal of Medical Case Reports 2010, 4:241 http://www.jmedicalcasereports.com/content/4/1/241 Abbreviations LA: left atrial; MV: mitral valve; PAI-1: plasminogen activator ... surface area was 2.8 cm and the peak pressure gradient across MV was mmHg with a mean pressure gradient of mmHg Following thrombolysis, intravenous anticoagulation (unfractionated heparin) was...

Ngày tải lên: 11/08/2014, 03:21

... interviews and selfadministered questionnaires on lifestyle and health related factors, medical history and respiratory symptoms were performed Cardiovascular (heart attack, stroke) and pulmonary diseases ... blood pressure and antihypertensive medication are highly correlated A detailed analysis of antihypertensive medication indicates that BBL medication and not any other antihypertensive medication ... Hypertension Association [20]: Antihypertensives (ATC code C02), diuretics (ATC code C03), beta-blocker (ATC code C07), calcium antagonists (ATC code C08), ACE inhibitors and angiotensin antagonists (ATC...

Ngày tải lên: 25/10/2012, 10:45

... from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns in gait and posture data may serve as an indicator ... properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm shift is the acknowledgment ... Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension analysis [13] This method recorded COP data and...

Ngày tải lên: 03/11/2012, 10:09

... low value lipids as feed stocks: Vegetable oil soap stock, Fuel Processing Technology 86 (2005): 1087 – 1096 Sukumar Puhan, Vedaraman N, Ramabrahamam B.V, Nagarajan.G, Mahua (Madhuca indica) seed ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... 16, 17] Alkali catalyzed transesterification is faster than acid catalyzed transesterification and is most used commercially [18] If the free fatty acid (FFA) content and moisture content are less...

Ngày tải lên: 05/09/2013, 16:11

... Therefore: Gage A = 93 kPa 97.4 kPa = 4.4 kPa (gage) = + 4.4 kPa (vacuum) Gage B = 105 kPa 97.4 kPa = + 7.6 kPa (gage) Ans 2.6 Express standard atmospheric pressure as a head, h = p/ g, in (a) feet ... (dx/dz)gradient Thus dx |gradient = 2Cx , integrate ũ dx = ũ 2C dz , x = const e 2Cz/B dz B x B Ans 2.5 Atlanta, Georgia, has an average altitude of 1100 ft On a U.S standard day, pressure gage A reads ... essentially a water barometer and, in principle, could hold a column of water up to 10 ft high! 2.28 What is the uncertainty in using pressure measurement as an altimeter? A gage on an airplane measures...

Ngày tải lên: 23/10/2013, 21:15

... transcription buffer were obtained from Fermentas (St Leon-Rot, Germany) RNA preparation The sequence of primer P1 (promoter primer) is 5¢-TAATA CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and that of primer P2 (reverse ... was designed to identify inactive hairpin ribozymes whose catalytic activity could be rescued by free exogenous adenine Its entire sequence is 5¢-CCTCCGAAACAGGACTGTCAGGGGG TACCAGGTAATGCATCACAACGTTTTCACGGTTGA ... the fraction of cleaved RNA at equilibrium, x the fraction of cleaved RNA at time t, and kobs the observed cleavage rate constant Keq was taken as the cleaved ⁄ uncleaved RNA concentration ratio...

Ngày tải lên: 07/03/2014, 00:20

... Hata, T., Hayashi, R & Doi, E (1967) Purification of yeast proteinases Part III Isolation and physicochemical properties of yeast proteinase A and C Agric Biol Chem 31, 357–367 Aibara, S., Hayashi, ... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications Dgly CPY and Dgly proCPY, in which the asparagine ... contrast to the two-state transition of the precursor form, mature CPY showed a multistate transition: a first transition in the 0.1–150 MPa range, a second from 150 to 450 MPa, and a third at pressures...

Ngày tải lên: 07/03/2014, 21:20

... Landai, Suka Damai, Malapari, Napal Sisik, Pelayangan, Rantau Kapas Mudo and Tuo), indicated that about 47% farmers undertake gap replanting in at least one of their rubber gardens (Wibawa et al., ... tradisonal di Propinsi Jambi, Sumatera Report submitted to ICRAF SEA Wibawa G, Boutin D and Budiman AFS 200 0a Alternatif pengembangan perkebunan karet rakyat dengan pola wanatani Proc Lokakarya dan ... intensitas cahaya ) Skripsi S2, Institut Pertanian Bogor, Indonesia: 115 pp Sanjaya KR 2001 Studi pengaruh bukaan tajuk pada regenerasi karet (Hevea brasiliensis Muell Arg.) secara alami pada sistem Agroforest...

Ngày tải lên: 23/03/2014, 22:20

... mixer and subjected to ultrasonication RESULTS Effects of pressure on Na+/K+-ATPase, Na+-dependent ATPase and K+-activated phosphatase activities It could be con®rmed that the Na+/K+-ATPase activity, ... (n), and Na+-dependent ATPase activities (m) Each activity was measured at various pressures and 37 °C as described in Experimental procedures Speci®c activities of Na+/K+-ATPase, K+-activated ... stoichiometry from half to a quarter J Biol Chem 273, 24334±24338 42 Yokoyama, T., Kaya, S., Abe, K., Taniguchi, K., Katoh, T., Ê Yazawa, M., Hayashi, Y & Mardh, S (1999) Acid-labile ATP and/or ADP/Pi binding...

Ngày tải lên: 24/03/2014, 00:21

Ngày tải lên: 28/03/2014, 23:20

... acid reagent Lipid A was isolated by preparative TLC The hydrophilic products were subjected to gel-filtration chromatography on Sephacryl S-200 HR (Amersham Pharmacia Biotech AB, Uppsala, Sweden) ... al [17] Alditol acetate, partially methylated alditol acetate, acetylated butyl glycoside and fatty acid methyl ester were analyzed by GC or GC-MS as described previously [7] SDS/PAGE was performed ... OPS-rich fraction (30%) Mainly two sugars, Rha and Man, were detected in the OPS-rich fraction on analysis of the sugar constituents (Table 1) The approximate molar ratio of Rha to Man was : Absolute...

Ngày tải lên: 31/03/2014, 23:20

... if any, the experience had had on the organisations and individuals taking part At that stage, it appeared that the impact on individuals had been generally more substantial than that on organisations ... backed by my experience – that, skilfully managed and facilitated, the opposite is true Over my last two decades as a consultant, facilitator and trainer, Strategic Choice has played a central ... ‘Obtaining Permissions’ British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloguing in Publication Data...

Ngày tải lên: 04/06/2014, 13:26

... wheelchair with a Vshaped seat (16” Model, KARMA MEDICAL PRODUCTS CO., LTD.) features an anti-sliding V-shaped seat that “sinks” to a maximum downward angle of 20 degrees, whereas the backrest can ... parameters were recorded to evaluate the pressure distribution at the seat interface These parameters include the mean pressure (MP) in the total contact area (> 5.2 mmHg) and the sacral peak ... physical therapist Geometric and mechanical parameters The geometric parameters include the degrees of sliding along the backrest (BS) and sliding along the seat (SS), which are standard measures also...

Ngày tải lên: 19/06/2014, 08:20