isolate a leak during leak test procedure number 3a andnumber 3b

... end-inspiratory pause Data were analyzed with a paired t -test and a multi-factorial analysis of variance for repeated measurements, where appropriate When the F value was significant, Tukey's test was used ... condition, Leakconv was significantly higher than Leakpause (Table 2) For a given cross-sectional area, and independently of model mechanics, Leakpause was not affected by V'I, whereas Leakconv increased ... mechanics on total leak, and second, to compare the total leak with that obtained when the inspiratory component was eliminated, leaving only the expiratory leak The inspiratory leak was eliminated...

Ngày tải lên: 12/08/2014, 20:20

... expiratory and total leak was constant (around one-third to one-quarter of the total leak) whatever the value of the leak, this suggests that factors affecting expiratory leak would similarly affect ... related with inspiratory flow and with compliance Airway resistance, which mostly affects expiration, affected total and expiratory leak similarly, with higher leaks at high resistances 32 What ... inspiratory leak, and thus total leak In the second part of the study, the authors used a lung model to evaluate the factors influencing the expiratory leak (and thus probably similarly the inspiratory...

Ngày tải lên: 12/08/2014, 20:21

... writing, translation and grammatical analysis The tests, for Heaton, also have a heavy literary and cultural bias He also criticized that public examination i.e secondary school leaving examinations ... the data from test trials are analyzed during the test development process to evaluate individual items as well as the reliability and validity of the test as a whole Test analysis is also carried ... testing reading as well as some literature to the test evaluation will be reviewed 1.1 Language testing 1.1.1 Approaches to language testing 1.1.1.1 The essay translation approach According to Heaton...

Ngày tải lên: 07/09/2013, 13:40

... GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG ... forward forward forward reverse reverse forward reverse forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC ... each acclimation temperature was quantified (Table 3) At AT ¼ 18 °C the ratio between b mRNAa ldh a and mRNAldh a is almost : However, at AT ¼ °C the specific total mRNAldh a content decreases and...

Ngày tải lên: 19/02/2014, 02:20

... health matters based on literature review The questionnaire was translated to Kiswahili as a language familiar to most Tanzanians Data was gathered by an anonymous questionnaire The knowledge test ... material and small group discussion This program is a feasible program for other areas in Tanzania Program evaluation Gallant and Maticka-Tydale compared reproductive health education programs applying ... 30 Wubs AG, Aarq LE, Flisher AJ, Bastien S, Onya HE, Kaaya S, Mathews C: Dating violence among school students in Tanzania and South Africa: Prevalence and socio-demographic variations Scand J...

Ngày tải lên: 22/03/2014, 12:20

... The advantage is that clients not have to perform any particular operation, since only standard ICMPv6 messages are exchanged between clients and MeshDVBoxes In this way MeshDV behaves totally ... low data rate increase congestion, interference, and delay Furthermore, as our measure proves, links with low transmission rates are usually more error-prone Traditional layered approach relegates ... device named C01S is an access point used to connect the test bed to the wired LAN through the S04 MeshDVBox that acts as a gateway On the wired LAN we have also an IPv6 DNS server and an IPv6-to-IPv4-proxy...

Ngày tải lên: 22/06/2014, 22:20

... the larger is the dynamic range ∆λ1 The eigenvalue variation is not necessarily linear, but the results obtained in this case can be generalized This type of variation has also the advantage ... to a high-resolution radar application The goal is to find the most accurate estimate of the range profile of a radar target using its complex signature in the frequency domain An Estimation of Number ... estimation, Ph.D thesis, Stanford University, Stanford, Calif, USA, 1981 [3] A Paulraj, R Roy, and T Kailath, A subspace rotation approach to signal parameter estimation,” Proc IEEE, vol 74,...

Ngày tải lên: 23/06/2014, 01:20

... raise Mr Jackson’s behavior and comments on occasions were inappropriate and fell below the standards A accept B acceptable C acceptance D accepting – “What an attractive hair style you have got!” ... to avoid the rain or the sun 36 Nga began playing the piano when she was ten A Nga has played the piano since she was ten B Nga played the piano since she has been ten C Nga has played the piano ... rain or the sun 34 Nga began playing the piano when she was ten A Nga has played the piano since she was ten B Nga played the piano since she has been ten C Nga has played the piano for she was...

Ngày tải lên: 28/07/2014, 01:20

... not hard to see that M1 + M2 + M3 + M4 is the adjacency matrix of K26 It is clear from Figure that there are no quadrilaterals The Ramsey number R4(C4) From the Ramsey number survey [3] we also ... Mi , so that M1 and M2 contain no K3 , and M3 and M4 contain no C4 Given a triangle-free graph on n vertices, one can construct a triangle-free graph on nm vertices by replacing each vertex ... critical colorings which show that R(K3 , K3 ) > and R(C4 , C4 ) > have the adjacency matrices X and Y Observe that X + Y + I is the all-ones × matrix We now construct four 26 × 26 adjacency matrices...

Ngày tải lên: 07/08/2014, 08:22

... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM...

Ngày tải lên: 07/08/2014, 18:21

... regard are two-dimensional grids [2, 3], Aztec diamonds [4], and honeycomb graphs [5] A reason this has attracted considerable interest, from both mathematicians and specialists in other areas, ... a compact formula for the number of matchings, but it involves irrational numbers (for example, for the number of matchings of a rectangular grid-graph as found in [2]) and thus information about ... The graph G3 have focused special attention on this problem when the graphs in question are planar, have a repeating pattern and/or have a geometric description Some important families of graphs...

Ngày tải lên: 07/08/2014, 21:21

... 237-244 Sato F, Kanno T, Nagasawa S, Yanaihara N, Ishida N, Hasegawa T, Iwanaga T Immunohistochemical localization of chromogranin A in the acinar cells of equine salivary glands contrasts with ... 422 Kazutaka Kanai et al were measured using a Human CgA enzyme-linked immunosorbent assay kit (Yanaihara Institute, Japan) All samples were analyzed in duplicate Salivary CgA concentrations ... 355-357 Nakane H, Asami O, Yamada Y, Harada T, Matsui N, Kanno T, Yanaihara N Salivary chromogranin A as an index of psychosomatic stress response Biomed Res 1998, 19, 401-406 Saruta J, Tsukinoki...

Ngày tải lên: 07/08/2014, 23:22

... ring area components with cambial age (A) EA; (B) LA All family mean values for EA increased after ring and reached a plateau between rings and After ring 7, family average tended to decrease ... differences among traits and allowed reliable comparisons of family covariances among different traits Covariance components, for each cambial age and transformed (standardized) traits, were also estimated ... relationship was assumed to estimate V AX = σ Fx (4) and σ where VAx Fx are the additive genetic variance and family variance component for trait X, respectively The final database was unbalanced...

Ngày tải lên: 08/08/2014, 00:21

... proof of Claim M By Subclaims M5, xu is not adjacent to b and is therefore adjacent to a and c In particular, we note that dG (b) = and that abcxu a is an induced 4-cycle in G that contains no vertex ... K Kawarabayashi, M D Plummer, and A Saito, Domination in a graph with a 2-factor J Graph Theory 52 (2006), 1–6 [9] A V Kostochka and B Y Stodolsky, On domination in connected cubic graphs Discrete ... Suppose that xu is adjacent to b Without loss of generality, we may assume that xu is adjacent to c By Subclaim M4, xu is therefore not adjacent to a Hence, dG (a) = and bcxu b is a triangle in...

Ngày tải lên: 08/08/2014, 12:23

... influence of a selection based on growth traits at early ages and later ages, as well as on wood quality related traits of radiata pine This research topic is relevant because the economic advantages ... ring density and radial growth Notice that during cambial ages and 9, covariances of family × block effects were negative (figures 3a and 3b) After ring 9, family covariation was negative but the ... covariance components that make up the phenotypic covariance For example, trends in family covariation with cambial age are shown in figures 3a, for ARD versus TRW, and 3b, for ARD versus RA At...

Ngày tải lên: 08/08/2014, 14:20

... neuroendocrine carcinoma Ear Nose Throat J 2004, 83:530-532 Alos L, Castillo M, Nadal A, Caballero M, Mallofre C, Palacin A, Cardesa A: Adenosquamous Carcinoma of the head and neck: criteria for diagnosis ... this article as: Huang et al.: A colliding maxillary sinus cancer of adenosquamous carcinoma and small cell neuroendocrine carcinoma a case report with EGFR copy number analysis World Journal of ... Hospital and Chang Gung University, Taiwan 3Department of Anatomy, Chang Gung University, Tao-Yuan, Taiwan 4Department of Plastic Surgery, Chang Gung Memorial Hospital and Chang Gung University, Taiwan...

Ngày tải lên: 09/08/2014, 03:22

... regarding the degree of synovitis and joint destruction One-half of the patient population was initially treated with analgesics followed by antimalarials or sulfasalazine if the initial treatment ... population At a diagnostic sensitivity equal to agglutinating RF, the secondgeneration anti-CCP2 assays detect ACPA of the IgG class with a superior diagnostic specificity for RA Studies on patients ... suggesting that the ACPA prevalence increases with increasing disease duration Prospective studies on early RA have shown that the antiCCP status is usually stable from the time of clinical presentation,...

Ngày tải lên: 09/08/2014, 07:20

... the advantages of minimal record maintenance and animal handling increase its attraction On the other hand, the arbitrary culling levels sometimes applied can be very far from the optimum values ... population were obtained by analysis of variancecovariance of full-sib families The expected response to selection for each trait separately (AG AG and ,) I2 for tht AMPO ODRIGUEZ aggregate genotype ... variance, mixed model, lines being considered as a fixed factor and replicates as a random factor Estimates of heritabilities and genetic and phenotypic correlations for both traits in the base...

Ngày tải lên: 09/08/2014, 22:22

... 10 Patient educational and clinician educational material Each article in the database was classified as being about KT or not about KT An example of a KT paper is one by Shojana and colleagues ... Medline and CINAHL that was available at the start of our grants (early 2007) Sample size calculations based on data from Yao and colleagues [21] showed that a database with approximately 110 ... 60 years of age, the general population over 60 years of age, and the relatives of patients who died after euthanasia or assisted suicide Their article is a KT article and also categorized as being...

Ngày tải lên: 11/08/2014, 05:21

... revealed an anaplastic ependymoma Our patient was seen by our pediatric oncologist for adjuvant chemotherapy Six months later, he underwent standard cranial Figure Brain magnetic resonance imaging ... Pediatrics 1992, 90:385-391 10 Federal Aviation Administration: Allowable carbon dioxide concentration in transport category airplane cabins [http:// www.airweb.faa.gov/Regulatory_and_Guidance_Library/rgNPRM.nsf/ ... sinuses At a cabin pressure of 575 mmHg, gas expands to 132% of its baseline volume at sea level [10] Expansion of intestinal gas may have brought about a mild elevation of intra-abdominal pressure...

Ngày tải lên: 11/08/2014, 12:20