isolate a leak during leak test procedure number 2

... 148 ± 12 137 ± 146 ± 139 ± 141 ± 11 Leakconv (ml) 23 9 ± 22 8 ± 24 4 ± 4ab 24 9 ± 10 24 3 ± 26 9 ± 7ab 24 3 ± 14 23 4 ± 25 4 ± 6ab Large area Small area Results are means ± SD V', constant inspiratory ... by deflating the cuff at the end of a s end-inspiratory pause Data were analyzed with a paired t -test and a multi-factorial analysis of variance for repeated measurements, where appropriate When ... that of the breath in which the cuff was deflated at the end of the inspiratory pause (26 .7 ± 7.1 cmH2O); the mean ∆Paw,peak averaged 2. 6 ± 2. 6 cmH2O (range 0.5–8 .2 cmH2O) As expected, Paw,peak...

Ngày tải lên: 12/08/2014, 20:20

... expiratory and total leak was constant (around one-third to one-quarter of the total leak) whatever the value of the leak, this suggests that factors affecting expiratory leak would similarly affect ... related with inspiratory flow and with compliance Airway resistance, which mostly affects expiration, affected total and expiratory leak similarly, with higher leaks at high resistances 32 What ... tracheal extubation for laryngeal edema Intensive Care Med 20 02, 28 : 126 7- 127 2 Prinianakis G, Alexopoulou C, Mamidakis E, Kondili E, Georgopoulos D: Determinants of the cuff -leak test: a physiological...

Ngày tải lên: 12/08/2014, 20:21

... 20 21 22 23 24 25 26 27 28 29 30 28 28 28 26 26 26 26 25 25 25 25 23 23 23 23 21 21 18 18 18 14 14 11 7 4 28 25 24 24 23 22 23 23 22 23 22 23 20 20 21 20 21 21 -3 19 -3 18 -3 19 -7 18 -7 14 -10 ... 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Whole 32 32 32 28 28 28 26 26 26 26 25 25 25 25 23 23 23 23 21 21 18 18 18 14 14 11 7 4 P.1 5 5 5 5 5 4 4 4 3 3 2 1 FINAL TEST P .2 P.3 8 7 6 5 4 ... 5 2 2 P.5 9 10 8 6 8 5 7 3 1 Whole 28 25 28 28 25 24 24 23 22 23 23 22 23 22 23 20 20 21 20 21 21 19 18 19 18 14 14 14 P.1 5 5 5 4 4 4 4 4 PET P .2 P.3 7 7 5 5 4 5 4 4 1 0 P.4 3 3 3 2 3 2 2 1 2...

Ngày tải lên: 07/09/2013, 13:40

... GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG ... forward forward forward reverse reverse forward reverse forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC ... between 60 and 72 °C) Rate constant of thermal inactivation (80 at 70 °C) Urea inactivation (10 at 20 °C) Heat capacity at 25 °C Calorimetric enthalpy of denaturation (scanning rate °CÆmin)1 at pH...

Ngày tải lên: 19/02/2014, 02:20

... health matters based on literature review The questionnaire was translated to Kiswahili as a language familiar to most Tanzanians Data was gathered by an anonymous questionnaire The knowledge test ... assistance Authors’ contributions FM collected data and FM and MI analyzed data FM and SH and MI participated in reviewing and drafting the manuscript in all stages All authors read and approved ... sexual behavior and lack of access to contraception Reprod Health Matters 20 00, 8: 52- 62 McCrann D, Lalor K, Katabaro KJ: Childhood sexual abuse among university students in Tanzania [abstract]...

Ngày tải lên: 22/03/2014, 12:20

... low data rate increase congestion, interference, and delay Furthermore, as our measure proves, links with low transmission rates are usually more error-prone Traditional layered approach relegates ... is that clients not have to perform any particular operation, since only standard ICMPv6 messages are exchanged between clients and MeshDVBoxes In this way MeshDV behaves totally transparent ... module and the client manager module collaborate to set up a communication between clients associated to different MeshDVBoxes by providing a lookup mechanism and a standard interface toward clients...

Ngày tải lên: 22/06/2014, 22:20

... discriminant function should capture in a suitable way the jump from the last eigenvalue associated to the signal subspace and the first eigenvalue associated to the noise subspace As it was stated above, ... the larger is the dynamic range ∆λ1 The eigenvalue variation is not necessarily linear, but the results obtained in this case can be generalized This type of variation has also the advantage ... estimation, Ph.D thesis, Stanford University, Stanford, Calif, USA, 1981 [3] A Paulraj, R Roy, and T Kailath, A subspace rotation approach to signal parameter estimation,” Proc IEEE, vol 74,...

Ngày tải lên: 23/06/2014, 01:20

... look D raise 22 Mr Jackson’s behavior and comments on occasions were inappropriate and fell below the standards A accept B acceptable C acceptance D accepting 23 – “What an attractive hair style ... rain or the sun 34 Nga began playing the piano when she was ten A Nga has played the piano since she was ten B Nga played the piano since she has been ten C Nga has played the piano for she was ... villages and museums across the country regularly perform ceremonies to ( 32) ……… the traditions alive 28 A soon 29 A control 30 A Although 31 A traditional 32 A catch B ago B to control B As B...

Ngày tải lên: 28/07/2014, 01:20

... journal of combinatorics 12 (20 05), #N14 21 11 11 21 16 22 10 15 17 25 26 12 13 20 13 23 19 19 14 24 26 18 10 14 18 16 23 17 20 12 24 15 25 22 Figure 2: The graphs with adjacency matrices M3 and ... M2 =  Y Y Y Y Y ¯       X X X X X ¯   Y Y Y Y ¯  ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T 0 0 0 0 21 16 16 17 12 11 22 11 21 10 15 20 25 13 18 23 24 26 13 18 23 19 14 26 25 20 14 19 15 10 24 22 ... not hard to see that M1 + M2 + M3 + M4 is the adjacency matrix of K26 It is clear from Figure that there are no quadrilaterals The Ramsey number R4(C4) From the Ramsey number survey [3] we also...

Ngày tải lên: 07/08/2014, 08:22

... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ] 62[ stset lacimehcoib dna )gniniats ... mutups namuH 8SpS 22 1E 1D 1C 3B 4A mutups namuH 22 SpS 12 1E 1D 1C 2B 4A mutups namuH 61SpS 02 4E 1D 1C 2B 4A mutups namuH 11SpS 91 3E 2D 1C 2B 4A mutups namuH 01SpS 81 1E 3D 2C 2B 9A mutups namuH ... dnallelCcM ,J hsleW 72 231- 921 ,17 ,10 02 icS minA J naidnI drocer raey evlewt ;slamina dna nam morf detalosi muiretcabocyM KS avatsavirS ,R amreV 62 14-93 ,11 ,20 02 seR teV J naidnI tropeR yranimilerP...

Ngày tải lên: 07/08/2014, 18:21

... regard are two-dimensional grids [2, 3], Aztec diamonds [4], and honeycomb graphs [5] A reason this has attracted considerable interest, from both mathematicians and specialists in other areas, ... a compact formula for the number of matchings, but it involves irrational numbers (for example, for the number of matchings of a rectangular grid-graph as found in [2] ) and thus information about ... The graph G3 have focused special attention on this problem when the graphs in question are planar, have a repeating pattern and/or have a geometric description Some important families of graphs...

Ngày tải lên: 07/08/2014, 21:21

... Organs 20 05, 180, 23 7 -24 4 Sato F, Kanno T, Nagasawa S, Yanaihara N, Ishida N, Hasegawa T, Iwanaga T Immunohistochemical localization of chromogranin A in the acinar cells of equine salivary glands ... 422 Kazutaka Kanai et al were measured using a Human CgA enzyme-linked immunosorbent assay kit (Yanaihara Institute, Japan) All samples were analyzed in duplicate Salivary CgA concentrations ... concentrations during a 24 -hour period in dogs Horm Metab Res 20 03, 35, 355-357 Nakane H, Asami O, Yamada Y, Harada T, Matsui N, Kanno T, Yanaihara N Salivary chromogranin A as an index of psychosomatic...

Ngày tải lên: 07/08/2014, 23:22

... ring area components with cambial age (A) EA; (B) LA All family mean values for EA increased after ring and reached a plateau between rings and After ring 7, family average tended to decrease ... method [ 32] , and the Taylor series expansion analysis [21 ] RESULTS AND DISCUSSION 3.1 Variation of family means with cambial age Family mean values for ED increased with cambial age for all families ... the ring area consisting of latewood and the total ring area Cumulative late proportion (CLP) at cambial age t was estimated as t ∑ LAi i =2 CLP t = t (2) ∑ RAi i =2 where LAi and RAi were...

Ngày tải lên: 08/08/2014, 00:21

... [8] K Kawarabayashi, M D Plummer, and A Saito, Domination in a graph with a 2- factor J Graph Theory 52 (20 06), 1–6 [9] A V Kostochka and B Y Stodolsky, On domination in connected cubic graphs Discrete ... there is a X2 -DS D2 in G2 such that |D2 | ≤ ψ(G2 ; X2 ) Since D2 ∪ {w1 } is a X-DS in G, we have that γ(G; X) ≤ |D2 | + ≤ ψ(G2 ; X2 ) + As |V (G2 )| = |V (G)| − 2, |X2 | = |X| − 1, sc(G2 ; X2 ) + ... [4] J Harant and D Rautenbach, Domination in bipartite graphs Discrete Math 309 (20 09), 113– 122 [5] T W Haynes, S T Hedetniemi, and P J Slater (eds.), Fundamentals of Domination in Graphs, Marcel...

Ngày tải lên: 08/08/2014, 12:23

... influence of a selection based on growth traits at early ages and later ages, as well as on wood quality related traits of radiata pine This research topic is relevant because the economic advantages ... study was to describe trends in genetic parameters of wood density and radial growth with cambial age MATERIALS AND METHODS 2. 1 Progeny test description Data came from a progeny test of radiata pine ... longitude 72o 27 ’ 20 ”W, altitude 122 m above sea level) The area is flat with a mean annual precipitation of 100 mm and a period of 4–5 months of drought The soil texture is sandy with a good drainage...

Ngày tải lên: 08/08/2014, 14:20

... neuroendocrine carcinoma Ear Nose Throat J 20 04, 83:530-5 32 Alos L, Castillo M, Nadal A, Caballero M, Mallofre C, Palacin A, Cardesa A: Adenosquamous Carcinoma of the head and neck: criteria for diagnosis ... Neuroectodermal neoplasms of the head and neck with emphasis on neuroendocrine carcinomas Mod Pathol 20 02, 15 :26 4 -27 8 Mineta H, Miura K, Takebayashi S, Araki K, Ueda Y, Harada H, Misawa K: Immunohistochemical ... neuroendocrine carcinoma of the nasal cavity and paranasal sinuses J Laryngol Otol 20 06, 120 :28 9 -29 7 Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, Jones CU, Sur R, Raben D, Jassem J, Ove...

Ngày tải lên: 09/08/2014, 03:22

... population At a diagnostic sensitivity equal to agglutinating RF, the secondgeneration anti-CCP2 assays detect ACPA of the IgG class with a superior diagnostic specificity for RA Studies on patients ... regarding the degree of synovitis and joint destruction One-half of the patient population was initially treated with analgesics followed by antimalarials or sulfasalazine if the initial treatment ... suggesting that the ACPA prevalence increases with increasing disease duration Prospective studies on early RA have shown that the antiCCP status is usually stable from the time of clinical presentation,...

Ngày tải lên: 09/08/2014, 07:20

... population were obtained by analysis of variancecovariance of full-sib families The expected response to selection for each trait separately (AG AG and ,) I2 for tht AMPO ODRIGUEZ aggregate genotype ... the advantages of minimal record maintenance and animal handling increase its attraction On the other hand, the arbitrary culling levels sometimes applied can be very far from the optimum values ... variance, mixed model, lines being considered as a fixed factor and replicates as a random factor Estimates of heritabilities and genetic and phenotypic correlations for both traits in the base...

Ngày tải lên: 09/08/2014, 22:22

... Medline and CINAHL that was available at the start of our grants (early 20 07) Sample size calculations based on data from Yao and colleagues [21 ] showed that a database with approximately 110 ... 10 Patient educational and clinician educational material Each article in the database was classified as being about KT or not about KT An example of a KT paper is one by Shojana and colleagues ... Journals are in alphabetical order work of categorization of the articles in the database Terms are available on a public Wiki called WhatisKT [24 ] Analyses Using custom-designed computer programs,...

Ngày tải lên: 11/08/2014, 05:21

... Hospital Medical Center, Tehran University of Medical Sciences, Tehran, Iran Received: 14 January 20 08 Accepted: 20 May 20 10 Published: 20 May 20 10 © 20 10 Mahdavi et al; from: http://www.jmedicalcasereports.com/content/4/1/143 ... sinuses At a cabin pressure of 575 mmHg, gas expands to 1 32% of its baseline volume at sea level [10] Expansion of intestinal gas may have brought about a mild elevation of intra-abdominal pressure ... revealed an anaplastic ependymoma Our patient was seen by our pediatric oncologist for adjuvant chemotherapy Six months later, he underwent standard cranial Figure Brain magnetic resonance imaging...

Ngày tải lên: 11/08/2014, 12:20