isolate a leak during leak test procedure number 2

Báo cáo y học: " Determinants of the cuff-leak test: a physiological study" ppsx

Báo cáo y học: " Determinants of the cuff-leak test: a physiological study" ppsx

... 148 ± 12 137 ± 146 ± 139 ± 141 ± 11 Leakconv (ml) 23 9 ± 22 8 ± 24 4 ± 4ab 24 9 ± 10 24 3 ± 26 9 ± 7ab 24 3 ± 14 23 4 ± 25 4 ± 6ab Large area Small area Results are means ± SD V', constant inspiratory ... by deflating the cuff at the end of a s end-inspiratory pause Data were analyzed with a paired t -test and a multi-factorial analysis of variance for repeated measurements, where appropriate When ... that of the breath in which the cuff was deflated at the end of the inspiratory pause (26 .7 ± 7.1 cmH2O); the mean ∆Paw,peak averaged 2. 6 ± 2. 6 cmH2O (range 0.5–8 .2 cmH2O) As expected, Paw,peak...

Ngày tải lên: 12/08/2014, 20:20

8 321 0
Báo cáo y học: "The cuff-leak test: what are we measuring" pps

Báo cáo y học: "The cuff-leak test: what are we measuring" pps

... expiratory and total leak was constant (around one-third to one-quarter of the total leak) whatever the value of the leak, this suggests that factors affecting expiratory leak would similarly affect ... related with inspiratory flow and with compliance Airway resistance, which mostly affects expiration, affected total and expiratory leak similarly, with higher leaks at high resistances 32 What ... tracheal extubation for laryngeal edema Intensive Care Med 20 02, 28 : 126 7- 127 2 Prinianakis G, Alexopoulou C, Mamidakis E, Kondili E, Georgopoulos D: Determinants of the cuff -leak test: a physiological...

Ngày tải lên: 12/08/2014, 20:21

3 297 0
EVALUATING a FINAL ENGLISH READING TEST FOR THE STUDENTS AT HANOI, TECHNICAL AND PROFESSIONAL SKILLS TRAINING SCHOOL – HANOI CON

EVALUATING a FINAL ENGLISH READING TEST FOR THE STUDENTS AT HANOI, TECHNICAL AND PROFESSIONAL SKILLS TRAINING SCHOOL – HANOI CON

... 20 21 22 23 24 25 26 27 28 29 30 28 28 28 26 26 26 26 25 25 25 25 23 23 23 23 21 21 18 18 18 14 14 11 7 4 28 25 24 24 23 22 23 23 22 23 22 23 20 20 21 20 21 21 -3 19 -3 18 -3 19 -7 18 -7 14 -10 ... 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Whole 32 32 32 28 28 28 26 26 26 26 25 25 25 25 23 23 23 23 21 21 18 18 18 14 14 11 7 4 P.1 5 5 5 5 5 4 4 4 3 3 2 1 FINAL TEST P .2 P.3 8 7 6 5 4 ... 5 2 2 P.5 9 10 8 6 8 5 7 3 1 Whole 28 25 28 28 25 24 24 23 22 23 23 22 23 22 23 20 20 21 20 21 21 19 18 19 18 14 14 14 P.1 5 5 5 4 4 4 4 4 PET P .2 P.3 7 7 5 5 4 5 4 4 1 0 P.4 3 3 3 2 3 2 2 1 2...

Ngày tải lên: 07/09/2013, 13:40

60 721 3
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG ... forward forward forward reverse reverse forward reverse forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC ... between 60 and 72 °C) Rate constant of thermal inactivation (80 at 70 °C) Urea inactivation (10 at 20 °C) Heat capacity at 25 °C Calorimetric enthalpy of denaturation (scanning rate °CÆmin)1 at pH...

Ngày tải lên: 19/02/2014, 02:20

11 663 0
Evaluation of a reproductive health awareness program for adolescence in urban Tanzania-A quasi-experimental pre-test post-test research pptx

Evaluation of a reproductive health awareness program for adolescence in urban Tanzania-A quasi-experimental pre-test post-test research pptx

... health matters based on literature review The questionnaire was translated to Kiswahili as a language familiar to most Tanzanians Data was gathered by an anonymous questionnaire The knowledge test ... assistance Authors’ contributions FM collected data and FM and MI analyzed data FM and SH and MI participated in reviewing and drafting the manuscript in all stages All authors read and approved ... sexual behavior and lack of access to contraception Reprod Health Matters 20 00, 8: 52- 62 McCrann D, Lalor K, Katabaro KJ: Childhood sexual abuse among university students in Tanzania [abstract]...

Ngày tải lên: 22/03/2014, 12:20

9 580 0
Báo cáo hóa học: " Research Article Evaluation of Cross-Layer Rate-Aware Routing in a Wireless Mesh Network Test Bed" pdf

Báo cáo hóa học: " Research Article Evaluation of Cross-Layer Rate-Aware Routing in a Wireless Mesh Network Test Bed" pdf

... low data rate increase congestion, interference, and delay Furthermore, as our measure proves, links with low transmission rates are usually more error-prone Traditional layered approach relegates ... is that clients not have to perform any particular operation, since only standard ICMPv6 messages are exchanged between clients and MeshDVBoxes In this way MeshDV behaves totally transparent ... module and the client manager module collaborate to set up a communication between clients associated to different MeshDVBoxes by providing a lookup mechanism and a standard interface toward clients...

Ngày tải lên: 22/06/2014, 22:20

10 344 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf

Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf

... discriminant function should capture in a suitable way the jump from the last eigenvalue associated to the signal subspace and the first eigenvalue associated to the noise subspace As it was stated above, ... the larger is the dynamic range ∆λ1 The eigenvalue variation is not necessarily linear, but the results obtained in this case can be generalized This type of variation has also the advantage ... estimation, Ph.D thesis, Stanford University, Stanford, Calif, USA, 1981 [3] A Paulraj, R Roy, and T Kailath, A subspace rotation approach to signal parameter estimation,” Proc IEEE, vol 74,...

Ngày tải lên: 23/06/2014, 01:20

12 409 0
A FORTY-FIVE MINUTE TEST TEACHER’S EVALUATION ppt

A FORTY-FIVE MINUTE TEST TEACHER’S EVALUATION ppt

... look D raise 22 Mr Jackson’s behavior and comments on occasions were inappropriate and fell below the standards A accept B acceptable C acceptance D accepting 23 – “What an attractive hair style ... rain or the sun 34 Nga began playing the piano when she was ten A Nga has played the piano since she was ten B Nga played the piano since she has been ten C Nga has played the piano for she was ... villages and museums across the country regularly perform ceremonies to ( 32) ……… the traditions alive 28 A soon 29 A control 30 A Although 31 A traditional 32 A catch B ago B to control B As B...

Ngày tải lên: 28/07/2014, 01:20

12 354 1
Báo cáo toán học: "A Note on Two Multicolor Ramsey Number" doc

Báo cáo toán học: "A Note on Two Multicolor Ramsey Number" doc

... journal of combinatorics 12 (20 05), #N14 21 11 11 21 16 22 10 15 17 25 26 12 13 20 13 23 19 19 14 24 26 18 10 14 18 16 23 17 20 12 24 15 25 22 Figure 2: The graphs with adjacency matrices M3 and ... M2 =  Y Y Y Y Y ¯       X X X X X ¯   Y Y Y Y ¯  ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T 0 0 0 0 21 16 16 17 12 11 22 11 21 10 15 20 25 13 18 23 24 26 13 18 23 19 14 26 25 20 14 19 15 10 24 22 ... not hard to see that M1 + M2 + M3 + M4 is the adjacency matrix of K26 It is clear from Figure that there are no quadrilaterals The Ramsey number R4(C4) From the Ramsey number survey [3] we also...

Ngày tải lên: 07/08/2014, 08:22

3 290 0
Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ] 62[ stset lacimehcoib dna )gniniats ... mutups namuH 8SpS 22 1E 1D 1C 3B 4A mutups namuH 22 SpS 12 1E 1D 1C 2B 4A mutups namuH 61SpS 02 4E 1D 1C 2B 4A mutups namuH 11SpS 91 3E 2D 1C 2B 4A mutups namuH 01SpS 81 1E 3D 2C 2B 9A mutups namuH ... dnallelCcM ,J hsleW 72 231- 921 ,17 ,10 02 icS minA J naidnI drocer raey evlewt ;slamina dna nam morf detalosi muiretcabocyM KS avatsavirS ,R amreV 62 14-93 ,11 ,20 02 seR teV J naidnI tropeR yranimilerP...

Ngày tải lên: 07/08/2014, 18:21

7 323 0
Báo cáo toán học: "A Note on Divisibility of the Number of Matchings of a Family of Graphs" ppt

Báo cáo toán học: "A Note on Divisibility of the Number of Matchings of a Family of Graphs" ppt

... regard are two-dimensional grids [2, 3], Aztec diamonds [4], and honeycomb graphs [5] A reason this has attracted considerable interest, from both mathematicians and specialists in other areas, ... a compact formula for the number of matchings, but it involves irrational numbers (for example, for the number of matchings of a rectangular grid-graph as found in [2] ) and thus information about ... The graph G3 have focused special attention on this problem when the graphs in question are planar, have a repeating pattern and/or have a geometric description Some important families of graphs...

Ngày tải lên: 07/08/2014, 21:21

4 344 0
Báo cáo khoa học: "Circadian variations in salivary chromogranin a concentrations during a 24-hour period in dogs" pps

Báo cáo khoa học: "Circadian variations in salivary chromogranin a concentrations during a 24-hour period in dogs" pps

... Organs 20 05, 180, 23 7 -24 4 Sato F, Kanno T, Nagasawa S, Yanaihara N, Ishida N, Hasegawa T, Iwanaga T Immunohistochemical localization of chromogranin A in the acinar cells of equine salivary glands ... 422 Kazutaka Kanai et al were measured using a Human CgA enzyme-linked immunosorbent assay kit (Yanaihara Institute, Japan) All samples were analyzed in duplicate Salivary CgA concentrations ... concentrations during a 24 -hour period in dogs Horm Metab Res 20 03, 35, 355-357 Nakane H, Asami O, Yamada Y, Harada T, Matsui N, Kanno T, Yanaihara N Salivary chromogranin A as an index of psychosomatic...

Ngày tải lên: 07/08/2014, 23:22

3 317 0
Báo cáo lâm nghiệp: "Genetic variation of wood density components in a radiata pine progeny test located in the south of Chile" pps

Báo cáo lâm nghiệp: "Genetic variation of wood density components in a radiata pine progeny test located in the south of Chile" pps

... ring area components with cambial age (A) EA; (B) LA All family mean values for EA increased after ring and reached a plateau between rings and After ring 7, family average tended to decrease ... method [ 32] , and the Taylor series expansion analysis [21 ] RESULTS AND DISCUSSION 3.1 Variation of family means with cambial age Family mean values for ED increased with cambial age for all families ... the ring area consisting of latewood and the total ring area Cumulative late proportion (CLP) at cambial age t was estimated as t ∑ LAi i =2 CLP t = t (2) ∑ RAi i =2 where LAi and RAi were...

Ngày tải lên: 08/08/2014, 00:21

10 341 0
Báo cáo toán học: "A new bound on the domination number of graphs with minimum degree two" docx

Báo cáo toán học: "A new bound on the domination number of graphs with minimum degree two" docx

... [8] K Kawarabayashi, M D Plummer, and A Saito, Domination in a graph with a 2- factor J Graph Theory 52 (20 06), 1–6 [9] A V Kostochka and B Y Stodolsky, On domination in connected cubic graphs Discrete ... there is a X2 -DS D2 in G2 such that |D2 | ≤ ψ(G2 ; X2 ) Since D2 ∪ {w1 } is a X-DS in G, we have that γ(G; X) ≤ |D2 | + ≤ ψ(G2 ; X2 ) + As |V (G2 )| = |V (G)| − 2, |X2 | = |X| − 1, sc(G2 ; X2 ) + ... [4] J Harant and D Rautenbach, Domination in bipartite graphs Discrete Math 309 (20 09), 113– 122 [5] T W Haynes, S T Hedetniemi, and P J Slater (eds.), Fundamentals of Domination in Graphs, Marcel...

Ngày tải lên: 08/08/2014, 12:23

35 259 0
Báo cáo khao học: "Genetic trends in wood density and radial growth with cambial age in a radiata pine progeny test" ppt

Báo cáo khao học: "Genetic trends in wood density and radial growth with cambial age in a radiata pine progeny test" ppt

... influence of a selection based on growth traits at early ages and later ages, as well as on wood quality related traits of radiata pine This research topic is relevant because the economic advantages ... study was to describe trends in genetic parameters of wood density and radial growth with cambial age MATERIALS AND METHODS 2. 1 Progeny test description Data came from a progeny test of radiata pine ... longitude 72o 27 ’ 20 ”W, altitude 122 m above sea level) The area is flat with a mean annual precipitation of 100 mm and a period of 4–5 months of drought The soil texture is sandy with a good drainage...

Ngày tải lên: 08/08/2014, 14:20

10 329 0
Báo cáo khoa học: "A colliding maxillary sinus cancer of adenosquamous carcinoma and small cell neuroendocrine carcinoma - a case report with EGFR copy number analysis" pot

Báo cáo khoa học: "A colliding maxillary sinus cancer of adenosquamous carcinoma and small cell neuroendocrine carcinoma - a case report with EGFR copy number analysis" pot

... neuroendocrine carcinoma Ear Nose Throat J 20 04, 83:530-5 32 Alos L, Castillo M, Nadal A, Caballero M, Mallofre C, Palacin A, Cardesa A: Adenosquamous Carcinoma of the head and neck: criteria for diagnosis ... Neuroectodermal neoplasms of the head and neck with emphasis on neuroendocrine carcinomas Mod Pathol 20 02, 15 :26 4 -27 8 Mineta H, Miura K, Takebayashi S, Araki K, Ueda Y, Harada H, Misawa K: Immunohistochemical ... neuroendocrine carcinoma of the nasal cavity and paranasal sinuses J Laryngol Otol 20 06, 120 :28 9 -29 7 Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, Jones CU, Sur R, Raben D, Jassem J, Ove...

Ngày tải lên: 09/08/2014, 03:22

5 342 0
Báo cáo y học: " Does a positive anti-CCP test identify a distinct arthritis entity" docx

Báo cáo y học: " Does a positive anti-CCP test identify a distinct arthritis entity" docx

... population At a diagnostic sensitivity equal to agglutinating RF, the secondgeneration anti-CCP2 assays detect ACPA of the IgG class with a superior diagnostic specificity for RA Studies on patients ... regarding the degree of synovitis and joint destruction One-half of the patient population was initially treated with analgesics followed by antimalarials or sulfasalazine if the initial treatment ... suggesting that the ACPA prevalence increases with increasing disease duration Prospective studies on early RA have shown that the antiCCP status is usually stable from the time of clinical presentation,...

Ngày tải lên: 09/08/2014, 07:20

3 312 0
báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx

báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx

... population were obtained by analysis of variancecovariance of full-sib families The expected response to selection for each trait separately (AG AG and ,) I2 for tht AMPO ODRIGUEZ aggregate genotype ... the advantages of minimal record maintenance and animal handling increase its attraction On the other hand, the arbitrary culling levels sometimes applied can be very far from the optimum values ... variance, mixed model, lines being considered as a fixed factor and replicates as a random factor Estimates of heritabilities and genetic and phenotypic correlations for both traits in the base...

Ngày tải lên: 09/08/2014, 22:22

9 249 0
Báo cáo y học: "A cross-sectional study of the number and frequency of terms used to refer to knowledge translation in a body of health literature in 2006: a Tower of Babel?" pps

Báo cáo y học: "A cross-sectional study of the number and frequency of terms used to refer to knowledge translation in a body of health literature in 2006: a Tower of Babel?" pps

... Medline and CINAHL that was available at the start of our grants (early 20 07) Sample size calculations based on data from Yao and colleagues [21 ] showed that a database with approximately 110 ... 10 Patient educational and clinician educational material Each article in the database was classified as being about KT or not about KT An example of a KT paper is one by Shojana and colleagues ... Journals are in alphabetical order work of categorization of the articles in the database Terms are available on a public Wiki called WhatisKT [24 ] Analyses Using custom-designed computer programs,...

Ngày tải lên: 11/08/2014, 05:21

11 599 0
Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps

Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps

... Hospital Medical Center, Tehran University of Medical Sciences, Tehran, Iran Received: 14 January 20 08 Accepted: 20 May 20 10 Published: 20 May 20 10 © 20 10 Mahdavi et al; from: http://www.jmedicalcasereports.com/content/4/1/143 ... sinuses At a cabin pressure of 575 mmHg, gas expands to 1 32% of its baseline volume at sea level [10] Expansion of intestinal gas may have brought about a mild elevation of intra-abdominal pressure ... revealed an anaplastic ependymoma Our patient was seen by our pediatric oncologist for adjuvant chemotherapy Six months later, he underwent standard cranial Figure Brain magnetic resonance imaging...

Ngày tải lên: 11/08/2014, 12:20

4 353 0
w