is there a tendency for the rate of profit to fall

Ngày tải lên: 12/08/2014, 20:20

... than that available on the display device requires quantization prior to display. Video halftoning performs this quantization so as to reduce visibility of certain artifacts. In many cases, visibility ... dividing the resulting sum by the total number of pixels in the frame. AFR is evaluated for all adjacent pairs of halftone frames and plotted as a function of frame number to give the flicker performance of ... discussed above, it is desirable to reduce these temporal artifacts in the halftone videos. Therefore, per- ceptual quantitative measures for evaluating these artifacts are desirable. Quantitative assessment...

Ngày tải lên: 21/06/2014, 08:20

Ngày tải lên: 08/08/2014, 21:20

Ngày tải lên: 13/08/2014, 23:20

... role in their health care. Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and Asthma Action Plan. The Asthma Test is used to assess the patient's ... diagnosis and management of asthma within the health centers. The Asthma Task Force developed medical record documents to facilitate superior asthma care (including an Asthma Test, Asthma Management ... severity and is completed by the patient (or parent) in the waiting room. It is low-literacy and is available in Spanish. The Asthma Management Plan is a progress note form that aids the provider...

Ngày tải lên: 14/02/2014, 13:20

... is the advantage of studying reactions to real art and the disadvantage that any two works of art differ from each other in several different respects, so that the actual factor responsible for ... the magnitude of the reward of the stimuli to be aesthetically judged probably corresponds to activity in the medial orbitofrontal cortex identified by Kawabata and Zeki (2004): images rated as ... during the visual perception of aesthetic objects” (Cela-Conde et al., 2004, p. 6321). Kawabata and Zeki (2004) wanted to verify whether there are brain areas that are consistently active across...

Ngày tải lên: 19/02/2014, 17:20

... class="bi x0 y4 w10 h5" alt=""

Ngày tải lên: 16/03/2014, 03:20

... know whether the set of automatic summaries is repre- sentative and therefore is not penalising certain au- tomatic summarisation strategies? Our goal is, therefore, to have some estimation JACK(X, M, A) ... Estimation of the quality of an automatic summary We are now looking for a function Q M,x (a) that estimates the quality of an automatic summary a ∈ A, given a set of models M and a similarity ... probabilistic framework, QARLA, for the evaluation of text summarisation systems. The in- put of the framework is a set of man- ual (reference) summaries, a set of base- line (automatic) summaries...

Ngày tải lên: 17/03/2014, 05:20

...

Ngày tải lên: 19/03/2014, 00:20

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC VL6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link...

Ngày tải lên: 23/03/2014, 13:20

... like to take this opportunity to thank all the team members for their contribution to the creation and nalisation of this report. Team Members: Anuradha Sanghavi Arun Swaminathan Avinash Kalia H.Sadhak Gautam ... Kalia H.Sadhak Gautam Mehra Harsh Bisht Jesal Lakdawala Malvika Singh Nehal D Sampat Nidhi Jain Sneha Bhagat Trisha Chatterji Vivek Prasad About PwC PricewaterhouseCoopers Pvt Ltd is a leading professional ... protability as well. One of these areas which are available is the offering of advisory services to offshore funds. There is a large amount of capital invested in India from overseas; Indian asset...

Ngày tải lên: 30/03/2014, 15:20

... with the synthesis of another; they may be thought of as a specialized variety of pattern- matching rule. They are local in nature, and permit the recursive analysis and synthesis of complex ... The pair of rules ':TA:PaulPaul' and ':TA: Maria Maria' are 'lexical transfer rules'; they state a transfer relation between atomic FSs (i.e. words, in the context ... alternative is to define equivalence classes of representations, and reduce all members of a class to the single canonical form which the grammar can map into a sen- fence. Exactly how the classes and...

Ngày tải lên: 01/04/2014, 00:20

... Chemistry Quantum Chemistry Software DFT Development of the usage of computational quantum chemistry, as measured by two different metrics. The top curve gives the number of citations to software ... chemistry is the study of chemistry via fundamental theoretical reasoning, usually within physics and mathematics. i h ˙ ψ = H ψ Quantum Mechanics S = k log W Statistical Mechanics I − Distribution at ... Calculations + Molecular Dynamics Computational Chemistry Computational chemistry is a branch of chemistry that uses principles of computer science to assist in solving chemical problems. Quantum...

Ngày tải lên: 02/06/2014, 09:45

... inducing apoptosis. In comparison, ΔN isoforms have little transactivation activity and play a role blocking target genes of p53 and their respective TAp73 isoforms [6]. Therefore, the TA isoforms may ... 5-FU/leucovorin, irinotecan, oxal iplatin, and capecitabine, and the role of targeted agents such as cetuximab and bevacizumab. The platinum-based chemotherapy drugs cisplatin, carboplatin, and oxaliplatin are among ... order to investigate if the increase in cell viability associated to K-Ras and B-Raf mutation after the treat- ment was mediated by p73, we analyzed the apoptotic TAp73 isoforms. Relative quantification...

Ngày tải lên: 18/06/2014, 16:20

... evaluation of all dot plots and wrote parts of the manuscript. LP coordinated the collection and assembly of data, did all statistical analysis and was involved in the interpretation of the data and manuscript ... minimize the impact of individual laboratory gating, analysis, and interpreta tion strategies, a censored analysis was also performed. For the censored analysis, three criteria were applied to determine ... acquisition Individual laboratories acquired the data on their flow- cytometer and analyzed the FCS files following labora- tory-specific analysis strategies and software. The requested format for presenting the...

Ngày tải lên: 18/06/2014, 22:20

... contributions SA carried out the collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript. LP coordinated the collection and assembly ... of data, did all statistical analysis and was involved in the interpretation of the data and manuscript writing. SJ did the overall project management, coordinated the distribution of material ... Representative dot plots from all participating labs will be made available upon request. Data Analysis and Interpretation Data generated by individual laboratories were evaluated in 2 ways Initial analysis...

Ngày tải lên: 20/06/2014, 04:20

... primary total hip arthroplasty and one patient had contractures follow- ing a revision from a bipolar to a total hip arthroplasty. The patients had a mean age of 48 years (range, 19 to 66 years). The ... also evaluated using the Harris hip score rating system [22]. Statistical Analysis Data was subjected to averaging and analysis using Sigma Stat software (version 3.00, Systat Corporation, San Jose, California). ... RED, MAM collected the data. MGZ, SDU, MSM, DRM analyzed the data. AB, MGZ, SDU, TMS, DRM prepared the manuscript. AB, MGZ, MSM, RED, MAM ensured the accuracy of the data and analysis. All authors have...

Ngày tải lên: 20/06/2014, 04:20

Ngày tải lên: 28/06/2014, 23:20

Ngày tải lên: 09/08/2014, 09:20