... forming a cavity 11 A in height The size of this cavity is comparable with that of adeninelacking cobalamins, and thus allows the damaged 4940 Materials Crystalline AdoCbl was a gift from Eisai ... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity ... and a Grant in Aid for Natural Sciences Research (to T Toraya) from the Asahi Glass Foundation, Tokyo, Japan We thank Y Kurimoto for her assistance with manuscript preparation References Banerjee...
... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual ... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated...
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... Zymed (San Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and Ni-NTA agarose ... the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase...
... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 382, 833–835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, ... imager after autoradiography scanning For each sample, data were expressed as a ratio of p44 ⁄ p42 MAPKs- or SAPK ⁄ JNK-phosphorylated proteins over total proteins, in absorbance units The mean...
... 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ a Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA-3¢ Primers used for ... 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Wild type Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle ... properties, although in somewhat different ways In general, however, we can distinguish between catalytically inactive and catalytically active mutants Catalytically inactive mutants All mutants of Asp893...
... or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin isa low-specificity ... plays an important role in the rRNA catalytic cleavage by a- sarcin, which would not be simply related to the bearing positive charge Both mutant variants of a- sarcin cleave ApA, with slight variation ... proposed that the mechanism of action of a- sarcin against ribosomes might differ in some details from that against dinucleotides [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether...
... Tsuchiya KJ, Takagai S, Kawai M, Matsumoto H, Nakamura K, Minabe Y, Mori N, Takei N: Advanced paternal age associated with an elevated risk for schizophrenia in offspring in a Japanese population Schizophr ... rare human disease has prompted research on complex common disease to focus on genetic approaches Table Sample classes as a function of parental or maternal age at birth Group Parental age at ... order/rank and schizophrenia may be due to paternal age In fact, as advanced paternal age was a risk factor for schizophrenia, the disease frequency was greater in children with higher birth rank as...
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... manuscript SL and TS evaluated and interpreted SNP microarray and aCGH data All authors read and approved the final manuscript for publication Acknowledgments We thank the heterotaxy patients and families...
... plasma viral load, age, education, adherence, and history of IDU were associated with HIV plasma viral load response The univariate and multivariate associations of aboriginal status, clinical and ... information on socio-demographic characteristics, there is always a chance for missing information To date several studies dealt with missing information via assumptions about the missing data or ... the HAART era, declines in deaths were smaller among racial minorities (black, Hispanic, Asian/Pacific Islanders, American Indian/Alaskan Native) compared with whites [45] These studies indicate...
... nuclear matrix proteins Proc Natl Acad Sci USA 1991, 88:10312-10316 51 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization signal of matrin is essential for vertebrate ... 5′GTCTCTCTGGTTAGACCAG-3′, Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC-3′ and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG-3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3′ and GAPDH ... http://www.retrovirology.com/content/8/1/61 reading and commenting on the manuscript, and Barbara Felber for sharing several critical reagents We are grateful to Anna Kula and Alessandro Marcello for sharing data in their paper prior...
... supported an asthma diagnosis Most patients with asthma are not cared for by asthma specialists and frequently the diagnosis is made on clinical grounds without formal pulmonary function testing Additionally, ... infiltrates or arterial hypoxemia The study excluded children with an exacerbation of reactive airways disease If patients with sickle cell disease are at increased risk of airway inflammation and ... hypoxemia, and a new infiltrate on chest x-ray that required hospitalization and a transfusion of packed red blood cells A cerebral vascular accident diagnosis was based on the new onset of an acute...
... with FACS Lyse (BD Catalog Nr 349202) Data was acquired for minutes from all patients at all visits Each day data was acquired, compensation controls were acquired, and data was compensated before ... the allergen concentration at which half-maximal activation (LC50) is achieved (e) LC50 was normalised to baseline and plotted against visit number Mikkelsen et al Clinical and Molecular Allergy ... salient clinical data for each patient Pt nr Treatment Side effects maintenance dose Ratio CD63 activation at 0,1/1 Traditional traditional fatigue 40000 1,07 weals 100000 1,05 traditional weals...
... endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant for vascular smooth muscle cells and fibroblasts and induces ... A major obstacle of utilizing NSCs in clinical applications is the need for fetal brain tissue There is limited availability of fetal tissue and it raises multiple moral and ethical complications ... glioma in vitro This experiment serves as an important foundation for further studies The transwell migration assay isa standard approach used for homing studies It is established, easy and convenient...
... Phosphate buffer saline Phosphatidylcholine Parkinson’s Disease PTEN-induced putative kinase Polyunsaturated fatty acids Standard error of mean Substantia Nigras par compacta Substantia nigras par ... plasmalogen has an ether linkage A major fatty acyl brain PE is arachidonic acid (AA, 20:4), with double bond starting at the omega-6 position AA is the precursor to signal molecules such as ... age-related neurodegenerative disorder (Elbaz and Moisan, 2008) The clinical characterization of the disease, started about half a century ago, is extremely accurate Among experienced clinicians,...
... developmental studies in vertebrate Zebrafish has many advantages over other vertebrate organisms Firstly, rapid external development makes translucent embryos available for visual analysis of tissue formation ... morphogenesis in zebrafish 1.3.4.1 Exocrine and endocrine pancreas in zebrafish Like the mammalian pancreas, zebrafish pancreas is also composed of two tissues, endocrine pancreas and exocrine pancreas, ... Finally, the small size of adult fish permits large numbers of these animals to be easily bred in a relatively small facility All these features make zebrafish as a suitable model organism for...
... products (base pairs) Target gene Forward primer Reverse primer Wilson gene 5¢-TGTTAAGTTTGACCCGGAAATTATC 5¢-CCGGTCAGCCAGCTGCTG 5¢-TGATGGTGGGCATGGGTCAG 5¢-TACATGGTGGTGCCGCCAGA a- actin (Perkin-Elmer ... Luciferase activity for each construct was normalized to b-gal activity, and the relative increases were calculated as the ratio of normalized activity in MREa/mutant transfected cells to that in ... (1993) Isolation and characterization of a human liver cDNA as a candidate gene for Wilson disease Biochem Biophys Res Commun 197, 271–277 Lutsenko, S & Kaplan, J.H (1995) Organization of P-type ATPases:...
... cycles, innovation streams, and ambidextrous organisations: organisational renewal through innovation streams and strategic change In Managing Strategic Innovation and Change, Tushman ML, Anderson ... organization Thus, innovation is no longer the domain of senior management but can arise anywhere and at any level in the organization Nonaka and Takeuchi (1995) see this new knowledge dissemination ... ago (Brand, 1998) The organisation isa good example of organisation's which, in the words of Nonaka and Takeuchi (1995), `ceaselessly innovate' These characteristics are increasingly important...
... JSP is also very powerful, faster than ASP, and instantly familiar to Java programmers It allows the Java program to leverage the aspects of the Java2 platform such as JavaBeans and the Java libraries ... Windows NT and many Unix versions, and it can be built as an Apache module and as a binary that can run as a CGI When built as an Apache module, PHP is especially speedy A downside is that you have ... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell...
... PTP1B, acts as a positive mediator of the ErbB2-induced signaling pathways that trigger mammary tumorigenesis and metastasis [12,13], and the tyrosine phosphatase SHP-2 isnecessaryfor activation ... P-labeled reduced carboxamidomethylated and maleylated lysozyme as substrate, and phosphatase activity was measured The results (shown as activity relative to wild-type phosphatase) are the mean ... covalent attachment of myristate, a 14-carbon saturated fatty acid, to the N-terminal Gly of eukaryotic and viral proteins The process is catalyzed by N-myristoyl transferase, and generally occurs...