... double passage section, you will likely find any combination of the above You can have: A letter and an email An invoice and an email An email and an email A schedule and a memo An article and a letter ... PSRA strategy An important strategy for reading comprehension is learning to approach a passage in an organized way First make a Prediction about the passage, then Page | 12 Scan it, next Read ... selection of an appropriate reading material is critical If the passage chosen is inappropriate for whatever reason, the chances of success for that particular lesson are substantially lessened For students...
Ngày tải lên: 14/12/2013, 16:45
... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of ... per unit area of land, compared to terrestrial oilseed crops Microalgae are very efficient biomass capable of taking a waste (zero energy) form of carbon (CO2) and converting it into a high density ... Materials and Methods Materials A microalgal strain of C vulgaris was kindly provided by Prof Hong-Nong Chou of The Institute of Fisheries Science, National Taiwan University, Taiwan All solvents and...
Ngày tải lên: 21/02/2014, 10:20
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx
... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of ... per unit area of land, compared to terrestrial oilseed crops Microalgae are very efficient biomass capable of taking a waste (zero energy) form of carbon (CO2) and converting it into a high density ... Materials and Methods Materials A microalgal strain of C vulgaris was kindly provided by Prof Hong-Nong Chou of The Institute of Fisheries Science, National Taiwan University, Taiwan All solvents and...
Ngày tải lên: 21/02/2014, 10:20
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... concentration, and lactate concentration, within the following physiologically feasible ranges: k kATPase k0 ATPase ATPase (small variation of the energetic load) k kATPase k0 ATPase ATPase (large variation ... effectors, all cellular kinases and phosphatases as potential chemical modiers, and all cellular membranes as potential activating or inactivating scaffolds However, the experimental effort actually ... mechanistic and simplied rate laws Table Ranking of saturation parameters for hepatocyte purine metabolism Average ranking of saturation parameters according to their impact on the dynamic stability...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx
... nanoparticle characterization, DC loading and imaging and data analysis CO YZ participated in nanoparticle characterization, DC imaging and data analysis MO participated in nanoparticle characterization, ... the statistical analysis and manuscript preparation DM participated in nanoparticle characterization, DC loading and data analysis VK participated in data analysis and supervised studies related ... encapsulated into nanoparticles, and data analysis VB participated in the design of the study, helped with the statistical analysis and manuscript preparation YZ participated in nanoparticle characterization,...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" doc
... nanoparticle characterization, DC loading and imaging and data analysis CO YZ participated in nanoparticle characterization, DC imaging and data analysis MO participated in nanoparticle characterization, ... the statistical analysis and manuscript preparation DM participated in nanoparticle characterization, DC loading and data analysis VK participated in data analysis and supervised studies related ... encapsulated into nanoparticles, and data analysis VB participated in the design of the study, helped with the statistical analysis and manuscript preparation YZ participated in nanoparticle characterization,...
Ngày tải lên: 20/06/2014, 03:20
báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx
... methods are used to validate conceptual meaning using phenomenological data (an inductive approach) and quantitative validation activities focus on measurement and operational activities associated ... individuals willing to take part in market research These databases are maintained by market research companies specifically for such purposes Some additional participants were recruited by asking database ... or moderate acne • Seen a dermatologist in the past years for their acne • An oily scalp and were also balding (males only) • Represented Asian, Black, Latino/Hispanic, White/ Caucasian peoples...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo y học: " B-cell depletion with rituximab: a promising treatment for diffuse cutaneous systemic sclerosis" doc
... 2:389-395 Daoussis D, Liossis SC, Tsamandas AC, Kalogeropoulou C, Kazantzi A, Korfiatis P, Yiannopoulos G, Andonopoulos AP: Is there a role for B-cell depletion as therapy for scleroderma? A case report ... standard for severe SSc) Long-term outcome analyses are essential to evaluate feasibility, safety, and efficacy of (repeat) treatment Criteria for retreatment should be developed once efficacy of a ... clinical trial protocol Such trials require a multicenter, maybe even a multinational, approach and concerted action from specialists, patients, and funding agencies Any such trial will be costly and...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps
... disease stability in 80% of patients after 2–3 doses of vaccine The mean survival rate was 13 months for melanoma patients and months for renal cell carcinoma patients [9] DC immunotherapy based ... phase II prostate cancer vaccine trial involving patients with hormone-refractory metastatic disease Prostate 1999, 38:73-8 Callegari-Jacques SM, Grattapaglia D, Salzano FM, Salamoni SP, Crossetti ... three main ethnic groups (Caucasian, Black, and Amerindians) Furthermore, the Brazilian racial pattern is characterized by extensive miscegenation [15,16] For this reason, we believe that mRNA molecules...
Ngày tải lên: 14/08/2014, 19:22
a new three-dimensional open-framework iron(iii) phosphate,
... the remaining P–O vertex being ‘terminal’ A Choudhury, S Natarajan / International Journal of Inorganic Materials (2000) 217 – 223 219 Table Crystal data and structure refinement parameters for ... initial characterization was carried out using powder X-ray diffraction (XRD) and thermogravimetric analysis (TGA) The powder XRD pattern indicated that the product is a new material; the pattern ... Empirical formula Crystal system Space group Crystal size (mm) ˚ a (A) ˚ b (A) ˚ c (A) b (8) ˚3 Volume (A ) Z Formula mass rcalc (g cm 23 ) ˚ l (MoKa) (A) m (mm 21 ) u range (8) Total data collected...
Ngày tải lên: 30/05/2014, 12:07
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... TGCAGCTTCAAGTAGGCTGAGGAA 3’) b-actin (forward, 5’ CTGGCACCACACCTTCTACAATGA 3’ and reverse, 5’ TTAATGTCACGCACGATTTCCCGC 3’) For each pair of primers, the following protocol was applied Initial denaturing: ... PAP: prostatic acid phosphatase; PCa: prostate cancer; PIN: prostatic intraepithelial neoplasm; PSA: prostate specific antigen; RNAi: RNA interference; shRNA: short-hairpin RNA Additional material ... in various human cancers including non-smallcell lung cancer, ovarian cancer, breast cancer, colon cancer, pancreatic cancer, liver cancer, oral cancer, head and neck cancer and neuroblastoma[12-20]...
Ngày tải lên: 18/06/2014, 19:20
o cáo hóa học:" Periostin: a promising target of therapeutical intervention for prostate cancer" pptx
... TGCAGCTTCAAGTAGGCTGAGGAA 3’) b-actin (forward, 5’ CTGGCACCACACCTTCTACAATGA 3’ and reverse, 5’ TTAATGTCACGCACGATTTCCCGC 3’) For each pair of primers, the following protocol was applied Initial denaturing: ... PAP: prostatic acid phosphatase; PCa: prostate cancer; PIN: prostatic intraepithelial neoplasm; PSA: prostate specific antigen; RNAi: RNA interference; shRNA: short-hairpin RNA Additional material ... in various human cancers including non-smallcell lung cancer, ovarian cancer, breast cancer, colon cancer, pancreatic cancer, liver cancer, oral cancer, head and neck cancer and neuroblastoma[12-20]...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt
... ohmic contact with an n+ region, a new material can be inserted between Ag and Si to form low barrier height (ΦB) and thus to reduce the contact resistance Among various materials, Mg metal is selected ... resistance To calculate the contact resistance, Mg was evaporated on the n-Si wafer, and the Ag paste was printed on the Si wafer for reference The contact resistances of Mg/Si and Ag/Si were measured ... oxidized Mg acting as antireflection coating [ARC] The illuminated currentvoltage characteristics under the global solar spectrum of AM 1.5 at 25°C, dark currentvoltage [DIV] characteristics, and the...
Ngày tải lên: 20/06/2014, 21:20
báo cáo hóa học: " Syndecan-1 antigen, a promising new target for triple-negative breast cancer immuno-PET and " potx
... in several cancer types, including breast, colorectal, gastric, pancreatic, prostate, lung, endometrial, and ovarian cancers, as well as squamous cell carcinoma of the head and neck and multiple ... for the animal facility, participated in in vivo assays and in the radiolabeling of mAb AF-C was responsible for high activity mAb radiolabeling JW produced the B-B4 antibody and critically revised ... GL, Horak ID, Goldenberg DM: Preclinical therapy of breast cancer with a radioiodinated humanized anti-EGP-1 monoclonal antibody: advantage of a residualizing iodine radiolabel Breast Cancer Res...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials" pptx
... powder XRD pattern shown in Additional file (SI 3) One might expect formation of crystalline Er O NPs after thermal annealing The nanohybrid materials have many potential applications compared with ... electrochemical measurements and NPs on MWNTs Abbreviations CNMs: carbon nanomaterials; CNTs: carbon nanotubes; MWNTs: multi-walled carbon nanotubes; NPs: nanoparticles; SWNTs: single-walled carbon nanotubes; ... inorganic nanomaterials: Preparations and applications Coord Chem Rev 2010, 254:1117, and the reference there in Banerjee S, Wong SS: Synthesis and Characterization of Carbon Nanotube-Nanocrystal...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc
... conditions Nanoparticles were not observed for a sample reacted for 12 h at room temperature (Fig 1a) , while almost uniform spherical nanoparticles were produced for sample heated at 100 °C for 12 ... non-toxic, and mass production route for the synthesis of other functional oxide materials Experimental Preparation of NiO Nanostructures In a typical synthesis, appropriate amount of nickel powder was ... indicate that the average diameter of the nanoparticles increases with the increase in reaction time, accompanied by an increase in aspect ratio A similar study using polyvinylpyrrolidone as precursor...
Ngày tải lên: 22/06/2014, 01:20
Báo cáo nghiên cứu khoa học " MACADAMIA – A PROMISING START TO A NEWHIGH VALUE AGRICULTURAL INDUSTRY FOR VIETNAM " potx
... Horticultural Research and Development Corporation, Australia http://www.macadamias.org Supattra Supamatee, et al 1992 Early performance of Australian and Hawaiian Macadamia Cultivars in Thailand Department ... 85-89 Australian Macadamia Society, Lismore Australia http://www.macadamias.org Hardner C 2002 Progress in MC98009: Rootstock Evaluation for the Australian macadamia industry Australian Macadamia ... demonstration nurseries there 2.3 A developmental strategy for a new macadamia industry for Vietnam This project has worked towards the formation of a Macadamia Association of Vietnam, which will play...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo y học: "Protein, iron, and meat consumption and risk for rheumatoid arthritis: a prospective cohort study" pps
... multivariate models fTotal iron was adjusted for total protein as well as for the same variables adjusted for in all the multivariate models gDietary and supplemental iron were adjusted for each ... median intake of each nutrient in each quintile as a continuous variable eAnimal and vegetable protein were adjusted for each other, total iron, and for the same variables adjusted for in all ... smoking, and total lifetime breastfeeding cProtein was adjusted for total iron as well as for the same variables adjusted for in all the multivariate models dAll P values for trend were calculated...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Adalimumab - an effective and promising treatment for patients with fistulizing Crohn’s disease: a case series" pdf
... recently, adalimumab, another TNF -a antagonist, has been approved in the US and EU for the treatment of CD Clinical trials have demonstrated that adalimumab is both effective for the induction and maintenance ... of patients with fistulas treated with adalimumab, along with an evaluation of the two-year maintenance of fistula closure during treatment with adalimumab (ADHERE trial) [7] This analysis has ... therapy [7,8] The ACCENT II trial assessed the efficacy of infliximab maintenance therapy in adult patients with CD who had at least one draining abdominal or peri-anal fistula over a period of at...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: " Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report" pdf
... Serology for Epstein-Barr virus, hepatitis A virus and hepatitis C virus was negative An autoimmune screen was negative (rheumatoid arthritis, antinuclear antibody, anti-mitochondrial antibody, anti-liver ... G2021 0A homozygosity for the prothrombin gene variant and mild deficiency of AT III affecting the liver A hepatic infarction is rare because of the richly anastamosing collateral arterial supply, and ... lethargy with reduced appetite A unilateral leg oedema was noticed A gastroscopy was normal and a computed tomography (CT) scan confirmed splenomegaly (13.5 cm), though he had a normal liver and...
Ngày tải lên: 11/08/2014, 12:20