invert a selection of files

architect drawings   a selection of sketches by world famous architects through history

architect drawings a selection of sketches by world famous architects through history

... Ainslie (Part A) National Archives of Australia, Series #41854 38, Accession #A7 10/1 63.2 ϫ 232.7 cm (A, B, and C); watercolor; 1911–1912 ©National Archives of Australia, A7 10, 48 Figure 7.6 / Saarinen, ... One example of a clearly architectural drawing dates from approximately 820 to 830 AD The Plan of St Gall was drawn on parchment and describes an ideal monastery Measuring 113cm vertically and ... wash for tonal qualities and shading, in both black and browns Natural chalk was also available; it was an immediate medium that facilitated quick sketches, and could be purchased in tones of...

Ngày tải lên: 27/05/2015, 10:51

289 478 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

... Health Association/American Water Works Association/Water Environment Federation, Washington DC, USA Tsuneda S., Nagano T., Hoshino T., Ejiri Y., Noda N and Hirata A (2003) Characterization of ... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8 ... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular...

Ngày tải lên: 05/09/2013, 10:15

8 482 0
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

... this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... chorismate mutase by combinatorial mutagenesis and selection: the importance of electrostatic catalysis Proc Natl Acad Sci USA 93, 5043–5048 11 Haslam, E (1993) Shikimic Acid: Metabolism and Metabolites ... Structure of Bacillus subtilis chorismate mutase The monofunctional chorismate mutase from B subtilis is a homotrimer and adopts a pseudo -a/ b barrel fold [38] A transition state analog, shown in a ball-and-stick...

Ngày tải lên: 19/02/2014, 12:20

8 635 0
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

... known, and the correction of such faults in adult life is a matter of considerable care and effort This manual has been prepared for practical use in the school-room and for the use of families and ... the best authority This may be illustrated by such words as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis, etc There are many words in our language about whose ... area r[+e]- 1 1 0 1 1 õr 0 0 1 0 0 ọr-md 1 1 ọr-mọd 2 0 armada * asphalt n 1 1 s-flt 2 1 s-prant 1 1 1 1 sp-rant aspirant sflt, not sfalt 2 0 0 assignee ss-n * attachộ ttsh[ +a] * audacious a- dshs...

Ngày tải lên: 22/03/2014, 16:22

156 470 0
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc

Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc

... Biochim Biophys Acta 1780, 914–920 Tamamura H, Imai M, Ishihara T, Masuda M, Funakoshi H, Oyake H, Murakami T, Arakaki R, Nakashima H, Otaka A et al (1998) Pharmacophore identification of a chemokine ... Kinetic data analysis was performed using biaevaluation 4.1 software employing a two-state reaction model in agreement with the presence of linked reactions Analysis of amino acid sequences Ala scanning ... frequency acted as an antagonist (IC50 = 23 lm) and displayed an affinity of 5.6 lm A discrepancy in the potency of clone in phage format (nanomolar range activity) and in peptide format (micromolar range...

Ngày tải lên: 28/03/2014, 22:20

12 299 0
Báo cáo khoa học: "A Framework of Feature Selection Methods for Text Categorization" potx

Báo cáo khoa học: "A Framework of Feature Selection Methods for Text Categorization" potx

... all data sets are (nearly) equally distributed cross all categories Classification Algorithm: Many classification algorithms are available for text classification, such as Naïve Bayes, Maximum ... probability distribution Both the left and right graphs have shadowed areas of the same size And the value of Ai − Bi can be rewritten as the following A − Bi Ai − Bi = i ⋅ Ai = (1 − ) ⋅ Ai Ai Ai ... Implementation: In the experiments, each dataset is randomly and evenly split into two subsets: 90% documents as the training data and the remaining 10% as testing data The training data are used...

Ngày tải lên: 30/03/2014, 23:20

9 406 0
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc

Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc

... with automatic and manual feature selection to eliminate the skewed nature of the data obtained, is a good way of building hedge classifier modules with an acceptable performance The analysis of ... classification as a standalone task In experiments we made use of the hedge classification dataset of scientific texts provided by (Medlock and Briscoe, 2007) and used a labeled dataset generated ... our feature selection process had unigram equivalents that were eliminated due to the noise present in the automatically generated training data We manually examined all keywords that had a P (spec)...

Ngày tải lên: 31/03/2014, 00:20

9 407 0
Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx

Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx

... polymerase was purchased from New England Biolabs The forward primer AB 348, 5¢-TTAGCAAAACCTC ATACAGAA-3¢, and the backward primer AB 349, 5¢-GATGCTGTCTTTCGCTGCTGAG-3¢, were used for DNA amplification ... resonance Phage ELISA appeared to be an efficient qualitative assay However, it cannot be used to measure accurate Kd values because the affinity of the Ig for phage particles probably takes part of ... Structural and kinetic characterization of a beta-lactamase-inhibitor protein Nature 368, 657–660 Strynadka, N.C., Jensen, S.E., Alzari, P.M & James, M.N (1996) A potent new mode of beta-lactamase...

Ngày tải lên: 31/03/2014, 01:20

7 428 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... AS-15 TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ... GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelated GFP–CDS ... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢...

Ngày tải lên: 31/03/2014, 15:20

10 432 0
báo cáo hóa học:" A survey of orthopaedic journal editors determining the criteria of manuscript selection for publication" potx

báo cáo hóa học:" A survey of orthopaedic journal editors determining the criteria of manuscript selection for publication" potx

... Spanish, Polish, German and Italian) We anticipated that most of these journal editors would either speak English as a second language or have access to a translator Non-respondents were approached ... [16,17] A Scandinavian study used a sham paper with either male or female authors to assess gender bias in a 1637 randomly selected Swedish physicians Female authors were ranked higher than male authors ... acceptance of a manuscript were: justified study conclusions, appropriate statistical analysis, study findings that could change practice, an understandable and well written manuscript and that...

Ngày tải lên: 20/06/2014, 04:20

6 677 0
báo cáo hóa học:" A survey of orthopaedic journal editors determining the criteria of manuscript selection for publication" pot

báo cáo hóa học:" A survey of orthopaedic journal editors determining the criteria of manuscript selection for publication" pot

... Spanish, Polish, German and Italian) We anticipated that most of these journal editors would either speak English as a second language or have access to a translator Non-respondents were approached ... [16,17] A Scandinavian study used a sham paper with either male or female authors to assess gender bias in a 1637 randomly selected Swedish physicians Female authors were ranked higher than male authors ... acceptance of a manuscript were: justified study conclusions, appropriate statistical analysis, study findings that could change practice, an understandable and well written manuscript and that...

Ngày tải lên: 20/06/2014, 07:20

6 243 0
Báo cáo khoa hoc:" Selection of as grandparental combinations a procedure designed to make use of dominance genetic effects" pot

Báo cáo khoa hoc:" Selection of as grandparental combinations a procedure designed to make use of dominance genetic effects" pot

... (AA x AA) x (aa x aa), because it produces heterozygous Aa grandoffspring Obviously, mating pairs AA x AA and aa x aa should be chosen to propagate the population SIMULATION Because of the rather ... obtain commercial animals and to propagate the a population The main aim of the present paper has been to propose this new procedure, which appears to be a general method of utilizing additive and ... is absent, as in the case of additive x additive epistasis [2] or when positive and negative effects of inbreeding are cancelled because at half of the loci d and at the other half d -1 (case...

Ngày tải lên: 09/08/2014, 18:21

11 216 0
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps

Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps

... animals have Ud and v genotypic values, and are related by Add Genotypic values of parents d and offsprings are related via A d It can be shown that the conditional expectation of a performance ... future offspring of some animal i of the parent population is equal to and the variance given the performances of all the ,i d Y of a animals is where us and vs are parts of equation (42), and Cs are ... Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13 (1992) 291-305 [14] Gavrilets S., Hastings A. , A quantitative...

Ngày tải lên: 09/08/2014, 18:21

29 347 0
Báo cáo sinh học: " Genetic improvement of litter size in sheep. A comparison of selection methods" potx

Báo cáo sinh học: " Genetic improvement of litter size in sheep. A comparison of selection methods" potx

... and ES, at least in the situation analysed (mass selection and equal information on candidates) Points (ii) and (iii) are especially relevant because the theory based on a linearisation of the ... this work, a simple nonlinear index (equation [1]) was examined The exact equation is an integral that implies marginalization with respect to a large number of variables The analytical solution ... correlation with LS and its high repeatability Measurement of OR would then allow us to decrease generation interval and increase the accuracy of genetic evaluation of young animals Certainly,...

Ngày tải lên: 09/08/2014, 18:21

19 296 0
Báo cáo sinh học: " Expected efficiency of selection for growth in a French beef cattle breeding scheme. I. Multistage selection of bulls used in artificial insemination" docx

Báo cáo sinh học: " Expected efficiency of selection for growth in a French beef cattle breeding scheme. I. Multistage selection of bulls used in artificial insemination" docx

... (1992) Sampling correlations between additive or maternal genetic variance and the directmaternal covariances are medium (0.3-0.6) Sampling correlation between additive variance and maternal variance ... easily explained by the fact that uncertainty was only considered for preweaning parameters Sampling standard deviations of differentials for Hs are in the range of uncertainty in maternal variance ... in preweaning parameters has a larger impact The same comments can be made for the standard deviations of the objective components (table VI) Standard deviations of direct and maternal responses...

Ngày tải lên: 09/08/2014, 18:21

22 373 0
báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx

báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx

... responses to selection obtained in each line was made by analysis of variance, mixed model, lines being considered as a fixed factor and replicates as a random factor Estimates of heritabilities and genetic ... programs, even though the advantages of minimal record maintenance and animal handling increase its attraction On the other hand, the arbitrary culling levels sometimes applied can be very far ... genetic and phenotypic correlations for both traits in the base population were obtained by analysis of variancecovariance of full-sib families The expected response to selection for each trait separately...

Ngày tải lên: 09/08/2014, 22:22

9 249 0
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot

Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot

... approximately three weeks after therapy simplification (Figure 1) Neither a preNNRTI GRT assay was available at that time, nor samples of plasma drawn in advance of the NNRTI-based treatment, had ... transmission Table GRT of proviral and plasma HIV, as interpreted by the Stanford HIV database algorithm (as of March, 2006) HIV-DNA resistance mutations HIV-RNA resistance mutations PI Major Resistance ... a year and a half In such a case, the authors postulated a possible eradication of the wild type quasispecies before HAART failure [13] Capetti et al reported the case of a HIV-infected woman...

Ngày tải lên: 11/08/2014, 14:21

5 428 0
Báo cáo y học: "Natural selection of protein structural and functional properties: a single nucleotide polymorphism perspect" potx

Báo cáo y học: "Natural selection of protein structural and functional properties: a single nucleotide polymorphism perspect" potx

... the statistical analysis JL and ZZ drafted the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available Additional data file ... paralog No paralog Presence of paralog V Pri Eu Un Hu A Ma ma ka ive ma mm erteb nima ryo rsa te n l rat al te l e Protein age Figure SNP A/ S3ratios and evolutionary variables SNP A/ S ratios and ... tal lica gna ce ruc ans ndin ote ote tr an id an dr as m as zy an an ac ytic se l tra pto tura por g in b in t ans nel ored sfer olas e ac eras e a me scrip slati r a l m te m tiv ac ac n re a...

Ngày tải lên: 14/08/2014, 08:21

17 312 0
Báo cáo sinh học: " Genetic parameters related to environmental variability of weight traits in a selection experiment for weight gain in mice; signs of correlated canalised response" pot

Báo cáo sinh học: " Genetic parameters related to environmental variability of weight traits in a selection experiment for weight gain in mice; signs of correlated canalised response" pot

... approach for canalisation analysis to better manage the model defined by San Cristobal-Gaudy et al [29] This Bayesian approach has previously been used in a mice population closely related to that ... environmental variability in mice 285 Table II Means of the posterior distribution of variance component estimates and genetic correlation (ρ) between mean and variance, using a Bayesian approach under ... identity matrix of equal order to the number of females having litters and σ2 and σ2∗ are the litter effect variances a ecting, respectively, each trait c c and its variation There are several estimations...

Ngày tải lên: 14/08/2014, 13:22

15 282 0
w