introduction to standard template library in c ppt

... expression vector was conceived by cloning in psiSTRIKE the pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega) The Rluc:miR-328 ... The HCV IRES nt 1-515 segment was amplified by PCR from pHCV7 7c using forward (5'-gcgcgcggatccgccagccccctgatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgaccgctcggaagtcttcc-3') oligonucleotides, ... PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT (5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3') binding sites into the PmeI site of psiCHECK (Promega) The integrity of the constructs

Ngày tải lên: 11/08/2014, 07:21

... (pronounced “deck”) is a double-ended queue #include #include #include int main (int argc, char *argv[]) { std::vector projects; – e.g., it provides (pre—re)allocation, indexed storage, push back(), ... Douglas C Schmidt What is STL (cont’d)? • A collection of composable class & function templates – – – – – The Standard Template Library provides a set of well structured generic C+ + components ... container provides factory methods for creating iterators: – begin()/end() for traversing from front to back – rbegin()/rend() for traversing from back to front Vanderbilt University Douglas C Schmidt

Ngày tải lên: 30/10/2015, 18:04

... khái lư? ?c (generic programming), C+ + cung c? ??p kèm với thư viện chuẩn STL Bộ thư viện th? ?c tồn c? ?ng vi? ?c vào liệu (iostream), quản lý mảng (vector), th? ?c hầu hết tính c? ??u tr? ?c liệu (stack, queue, ... phần chính: Container, Iterator Algorithm Tôi đưa số khái niệm chúng: 1.1.2 Containers Một container đối tượng c? ?? thể lưu trữ tập đối tượng kh? ?c (c? ?c phần tử nó) Nó th? ?c lớp mẫu (class templates) ... ô nhớ chứa Container Chúng ta sử dụng Iterator để duyệt qua phần tử Container Iterator đóng vai trị c? ??u nối quan trọng Algorithm với Container Mỗi loại Container kh? ?c lại c? ? loại Iterator tương

Ngày tải lên: 18/08/2020, 22:11

... – Container adapter – tương thích container • stack, queue, priority_queue C? ?c hàm thành viên STL • C? ?c hàm thành viên container c? ? – – – – – Default constructor, copy constructor, destructor ... using std::cout; using std::endl; #include #include // algorithm definitions // vector class -template definition bool greater10( int value ); // prototype int main() { const int SIZE = 10; int ... container • Algorithm: thuật tốn để thao t? ?c liệu, tìm kiếm, xếp, v.v Giới thiệu Container • loại container – Sequence container – container chuỗi • c? ??u tr? ?c liệu tuyến tính (vector, danh sách

Ngày tải lên: 12/12/2022, 10:12

... thiệu Container • loại container – Sequence container – container chuỗi • c? ??u tr? ?c liệu tuyến tính (vector, danh sách liên kết) • first-class container • vector, deque, list – Associative container ... C? ?c hàm thành viên STL • C? ?c hàm thành viên container c? ? – – – – – Default constructor, copy constructor, destructor empty max_size, size = < >= == != swap • C? ?c hàm thành viên first-class container ... phần tử begin() trả iterator trỏ tới phần tử end() trả iterator trỏ tới phần tử đ? ?c biệt chặn cuối container C? ?c loại Iterator • Input (ví dụ: istream_iterator) – Đ? ?c phần tử từ container, hỗ trợ

Ngày tải lên: 11/07/2014, 07:21

... arrowheads indicate the 37 amino acid residues involved in DNA binding activity. Filled arrowheads correspond to the seven amino acid residues involved in DNA binding activity that are changed in EhTBP sequence. ... speci? ?c competitor (sc); lane 4, 300-fold molar excess of unspeci? ?c competitor (uc). (D) EMSA using 15 lg of bacterial extracts. Lane 1, free probe; lane 2, non induced bacteria (nib) carry- ing ... and gels were Fig. 7. Predicted amino acid residues involved in EhTBP binding to DNA. Conserved C- terminal domain sequences of TBPs from Saccharomycces cerevisiae (ScTBP) (P13393), Arabidopsis

Ngày tải lên: 16/03/2014, 18:20

... decline in welfare (Conning and Udry 2005) I. Introduction Microcredit is an increasingly common weapon in the fight to reduce poverty and promote economic growth. Microlenders typically ... increases. We find no evidence of improvements in measures of subjective well-being; if anything, the results point to a small overall decrease. In all, we find that increased access to microcredit ... thin, and our Lender does not use credit bureau information as an input into its scoring. Scores range from 0 to 100, with applicants scoring below 31 rejected automatically and applicants scoring

Ngày tải lên: 29/03/2014, 07:20

... simple //: C0 4:WordSet.cpp #include " /require.h" #include #include #include #include using namespace std; int main(int argc, char* argv[]) { requireArgs(argc, 1); ifstream source(argv[1]); ... Standard Template Library (STL library) Now consider taking the form of Intset.cpp and reshaping it to display a list of the words used in a document The solution becomes remarkably ... source(argv[1]); assure(source, argv[1]); string word; set words; while(source >> word) words.insert(word); copy(words.begin(), words.end(), ostream_iterator(cout, "\n")); cout

Ngày tải lên: 05/07/2014, 19:20

... Deduction, induction and abduction are quantitative They include or exclude meanings and include or exclude particular conclusions Evidence `adds up' Even guessing involves choices that include ... open to critique 60 DEFINING THE INQUIRY MAIN POINTS There are three major styles of reasoning in social science research Deduction involves conclusions about evidence that necessarily occur ... them to predict what is going to happen This is nomothetic Dr Spock in the science fiction Star Trek is presented as a cold, calculating, character who thinks only logically and scientifically

Ngày tải lên: 06/07/2014, 00:20

... of the Pacific war The commentator's conclusion was that it would take at least two years to finish the war in the Pacific after Victory in Europe `One Side' The major topics included in the program ... quantitative social science research are similarly a thing apart from us Our research designs and our research definitions are open to scrutiny and criticism Even if we guess in social science research ± ... personal involvement in research Some methods of detection in social science research involve the researcher as the `data collecting instrument', such as participant observation Participant observation

Ngày tải lên: 06/07/2014, 00:20

... the fact. I had to proceed carefully' (Christie, 1982: 247). Proof of the fact is a part of data analysis in social science research. Proceeding carefully is exactly what you need to do ... A Carrier B FIGURE 5. 7 A different way to display... Percentiles to generate values corresponding to each percentile Click Continue and then click OK You should then have the following ... never comes to the social scientist clean, like cement for bricks. As we found in Chapters 3 and 4, the society a person lives in ± and a person's beliefs ± can directly affect what counts

Ngày tải lên: 06/07/2014, 00:20

... một c? ?ch c? ? chủ ý. Khi c? ?c thủ t? ?c quy trình không đư? ?c chuẩn hoá ở m? ?c độ cao, c? ?c công nhân c? ? thể c? ? những ý nghĩ kh? ?c nhau về c? ?ch làm đúng cho một thủ t? ?c quy trình và dễ đưa đến c? ?c giả ... vi? ?c chi tiết hoá c? ?ng vi? ?c chỉ rõ từng bư? ?c thao t? ?c cho mỗi c? ?ng nhân. Ví dụ với c? ?ng đoạn c? ??t gỗ, trình tự c? ?ng vi? ?c chuẩn sẽ mô tả từ chi tiết c? ??t và c? ?c bư? ?c thao t? ?c như chuẩn bị máy, chỉnh ... video cho c? ?c loại c? ?ng vi? ?c ph? ?c tạp hay c? ?c vấn đề liên quan về an to? ?n lao động. 16 Yêu c? ??u 7.5.1. nói rằng “một tổ ch? ?c cần c? ? c? ?c tài liệu sau: a) thông tin về c? ?c đ? ?c tính c? ??a sản

Ngày tải lên: 07/08/2014, 02:20

... as AOA increases and aft as AOA decreases, producing pitching moments. This characteristic makes the center of pressure difficult to use in aerodynamic analysis. Since the moment produced about ... relative wind and the chord line, and the pitch angle is formed between the TPP and the chord line. Lift, which is the total aerodynamic force perpendicular to the local vector velocity, or ... lowering the nose of the blade. The resulting blade performance characteristics include low pitching moments and high stall AOA the retreating blade. The significance of this second characteristic

Ngày tải lên: 08/08/2014, 13:20

... product price • Calculate the total cost and use return to send the calculated cost back to the caller • Call calculate_cost(), setting $total_cost to whatever value is returned from the function ... how calculate_cost() returns a value $total_cost = calculate_cost ($tax, $price); // round the cost to two decimal places $total_cost = round($total_cost, 2); print "Total cost: ".$total_cost; ... applications There are several instances in later chapters in which I make use of arrays to improve coding efficiency and clarity Chapter continues our survey of PHP’s basic functionality, discussing

Ngày tải lên: 09/08/2014, 12:22

... refer- encing and declaring entities in the upcoming section “The Document Type Definition (DTD).” Processing Instructions Processing instructions, commonly referred to as PIs, are external commands ... useful when a certain piece of infor- mation may change in the future or continued explicit referencing of that infor- mation is too tedious a process to repeat. I’ll delve further into the details ... unearthing three general concepts that would make it possible to begin sharing documents across operating systems and applications: • The document-processing programs must all be able to communicate

Ngày tải lên: 09/08/2014, 12:22

... method b) instance d) struct 63. The constructor without parameters is called _________. [0.5] a) main constructor c) default constructor b) zero valued constructor d) non-parameterized constructor 64. ... is called automatically when the object is accessed. c) A static constructor can have public as a accessibility modifiers 74. class A { public static int X = B.Y + 1; } class B { public static ... actions required to initialize a class. d) A static constructor cannot have accessibility modifiers. b) Static constructors may or may not take parameters. e) A static constructor for a class...

Ngày tải lên: 09/04/2013, 09:10

... constructors can be called explicitly or implicitly. b) Static constructors can have accessibility modifiers. e) Static constructors are called when the class is loaded. c) Static constructors ... class is called automatically when the object is accessed. c) A static constructor can have public as a accessibility modifiers 74. class A { public static int X = B.Y + 1; } class ... The code fails to compile. 75. Which of the following statements are true with respect to Static constructors. [1.5] a) Static constructors cannot take parameters. d) Static constructors...

Ngày tải lên: 21/08/2012, 15:55

... 104. Which of the following are correct statements for implementing an abstract class. [1.0] a) public abstract void class ClassA c) abstract public ClassA b) public abstract class ClassA ... to an int data type. 203. Which of the following is the correct syntax for declaring an indexer. [1.0] a) protected int this[int var1] c) public int this(int var1) b) public int classname[int ... name of class MyClass is : [1.5] a) Space1.MyClass() c) Space1.Space2.MyCl ass() b) Space2.MyClass() d) Space2.Space1.MyCla ss() 141. namespace College .Library{ namespace Shelf{ class...

Ngày tải lên: 29/08/2012, 16:37

... Iterators  Containers hold objects, all of a specified type  Generic algorithms act on objects in containers  Iterators provide access to objects in the containers yet hide the internal structure ... container c  c. begin( ); // returns an iterator to the first // element in container c  c. end( ); // returns an iterator to a position // beyond the end of the container c.  c. rbegin( ); ... into constant and mutable iterator.  Constant Iterator cp does not allow assigning element at p using std::vector<int>::const_iterator; const_iterator cp = v.begin( ); *cp = something;...

Ngày tải lên: 12/09/2012, 22:55

... the GPOs by using the hierarchical nature of Active Directory. Topic Objective To introduce Active Directory. Lead -in Active Directory forms the basis of a number of CCM technologies. ... 10 Module 1: Introduction to Change and Configuration Management Design Defining the Scope of the CCM Infrastructure  Defining Organizational Scope  Defining Technical Scope 10.1.50.0 ... CCM technologies as a project. To maximize the project’s chances of success, you must understand the existing CCM process, follow a process to implement a CCM infrastructure, create a CCM design...

Ngày tải lên: 10/12/2013, 15:15