integration of gene expression components for discovery

... analysis of gene expression: rapid RT-PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 34 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial analysis of gene ... (2005) Analysis of long-lived C elegans daf-2 mutants using serial analysis of gene expression Genome Res 15, 603–615 10 Ryu EJ, Angelastro JM & Greene LA (2005) Analysis of gene expression changes ... expression tags for gene identification Proc Natl Acad Sci USA 97, 349–353 35 Richards M, Tan SP, Chan WK & Bongso A (2006) Reverse serial analysis of gene expression (SAGE) characterization of...

Ngày tải lên: 07/03/2014, 00:20

... resistance gene ABCB1 (formerly expressed large numbers of genes characteristic of melanoma and MDR1) had closely related drug-activity profiles HCT-15, with one of the highest levels of ABCB1 expression, ... the expression patterns of genes over the 60 cell lines These correlation coefficients were calculated for each combination of a gene and a drug by taking the (normalized) level of expression of ... respect to drug mechanisms of action Gene- drug correlations on the basis of gene expression and drug activity (AT-matrix clustering) We analysed expression profiles of the 1,376 genes plus 40 individually...

Ngày tải lên: 30/03/2014, 13:20

... 41 genes ↑ 56 genes ↑ gene ↓ DNA-repair gene ↓ genes ↑ gene ↓ 14 genes ↑ oncogenes/tumor related genes gene ↑ 11 genes ↓ genes ↑ 11 genes ↓ 13 genes ↑ 10 genes ↓ cell adhesion genes ↑ genes ↓ genes ... system genes ↑ 13 genes ↓ genes ↑ 19 genes ↓ genes ↑ 25 genes ↓ 13 genes ↓ genes ↑ genes ↓ 18 genes ↑ 10 genes ↓ signal transduction transcription gene ↑ genes ↓ 10 genes ↑ genes ↓ 22 genes ↑ genes ... transport genes ↑ 12 genes ↓ 11 genes ↑ 15 genes ↓ genes ↑ 15 genes ↓ development gene ↑ genes ↓ genes ↑ genes ↓ 12 genes ↑ genes ↓ calcium-binding genes ↑ genes ↓ gene ↓ apoptosis unknown genes ↓ genes...

Ngày tải lên: 18/06/2014, 15:20

... dimerization of the 50 kDa NF-κB subunit (p50) and regulates the transcriptional activity of p50 to the transcription of an array of inflammatory genes, their direct regulation of MMP transcription ... pathways inhibits gene expression of MMPs in Arthritis Research Vol No Vincenti and Brinckerhoff tissue culture experiments, and prevents progression of arthritis in animal models For example, the ... the work of Bondeson et al [73], in which over -expression of IκBα reduced expression of inflammatory cytokines and MMPs, but did not reduce anti-inflammatory cytokines or tissue inhibitor of metalloproteinases...

Ngày tải lên: 09/08/2014, 03:24

... parameters: 50°C for and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for To determine the expression of a specific gene, SpZ12-1 amplification for normalizing measurements of the absolute ... Snail Figure Coexpression of genes in SMC cells Coexpression of genes in SMC cells Whole-mount in situ hybridization (WISH) analysis of examples of signaling and transcription factor genes identified ... may be a requirement for apical organ formation and neurogenesis, and one of the possible actions of zinc treatment on embryogenesis A Figure treated embryos Expression of endomesoderm markers...

Ngày tải lên: 14/08/2014, 07:21

... signature gene 'Concordant Similarity' is the number of concordant genes expressed as a percentage of the total number of genes in the signature 'Discordant Similarity' is the number of discordant genes ... than UniGene clusters [36] Second, for every two groups of samples in a dataset, we generated an expression signature Following file conversion, each gene was assessed for the significance of differential ... significant genes with Q value of 0.2 or less was generated For each significant gene, a Q score was calculated as the logarithm of reciprocal Q value (-log [Q value]) Finally, a gene expression...

Ngày tải lên: 14/08/2014, 07:22

... total number of detected genes Hence, controlling the FDR may be a reasonable strategy The non-Normality of gene- expression data hampers the ranking of the gene- expression effects for their statistical ... order of magnitude as the empirical estimate of the FDR DISCUSSION Seven alternative methods for the analysis of gene expression data were compared for their empirical false discovery rates of differentially ... the geneexpression effects Another alternative is to use non-parametric bootstrapping in order to account for any non-normality of the transformed gene- expression data [8] However, which of these...

Ngày tải lên: 14/08/2014, 13:22

... QTLs for gene expression can be classified according to the chromosomal location of the QTL relative to the location of the gene being expressed Those for which the location of the QTL and gene ... human gene expression Nature 2004, 430:743-747 The GeneNetwork [http://www.genenetwork.org/search.html] Chesler EJ, Wang J, Lu L, Qu Y, Manly KF, Williams RW: Genetic correlates of gene expression ... the tissue of origin Raw probe 100 200 300 100 200 300 Figure Distribution of P-values from QTL mapping of brain RNA expression Distribution of P-values from QTL mapping of brain RNA expression...

Ngày tải lên: 14/08/2014, 14:21

... Networks and Gene- Expression Profiles for the Analysis of Diseases LIM JUNLIANG KEVIN (B.Comp (Hons.), NUS) A DOCTORAL THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF COMPUTER ... datasets stored in different geneexpression repositories; cf fig 1.1 Figure 1.1: Number of gene- expression profile datasets in database repositories This quantitative measure of gene transcripts at once ... some of these problems by incorporating biological information into their framework in the form of gene sets These gene sets represent biological processes or pathways that are known to perform...

Ngày tải lên: 09/09/2015, 10:15

... Labeling of a PCR-amplified probe with DIG as part of in situ RT-PCR indirect detection of gene expression expression standard RT-PCR was performed showing specific amplification of the TNF gene For ... intensity of green versus red This gives a measure of the relative levels of the competing mRNAs bound to each spot and so provides information on the relative level of expression of the genes on ... success of both the DNA elution and re-amplification depends on the amount of cDNA generated during the first round of PCR A good way of optimizing the first round PCR is to take advantage of known genes...

Ngày tải lên: 25/10/2013, 22:20

... control of gene expression As each step of the RNA metabolism is tightly regulated, the regulation of mRNA export, stability and translation rate is essential for the control of the expression of ... activity of both RRMs Finally, the association of ASF ⁄ SF2 with TIAR led us to investigate its role on the expression of reporter gene bearing an ARE in its 3¢ UTR We showed that overexpression of ... might modulate the expression of ARE-containing genes Accordingly, we tested the effect of overexpressing ASF ⁄ SF2 on the expression of Renilla luciferase (Rluc) reporter genes carrying (or...

Ngày tải lên: 16/02/2014, 15:20

... major source of variability in gene expression For this reason, special care must be taken when tumors are sampled for gene expression analysis In general, macro- or micro-dissection of the samples ... gene predictors not involved ‡ in one of the gene expression profile tests of interest: 150 Article does not involve one of the three gene expression tests of interest: 659 No original data or ... expression measurements of individual genes of the 70 -gene expression profile, as well as on the 182 most highly expressed genes In the second phase of the study, the assay performance was evaluated...

Ngày tải lên: 06/03/2014, 01:20

... standard PCR condition (first PCR, 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s for 15 cycles; second PCR, 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s for 25 cycles) The PCR products were ... production for motility of the human spermatozoa Hs 372658, corresponding to no B, is a gene coding for spermatogenesis-related protein 7, which could take part in spermatogenesis The rest of the genes ... the PCR The PCR program consisted of 25 cycles of 94 °C for 30 s, 66 °C for 30 s and 72 °C for The final extension step consisted of 72 °C for Ten microliters of the PCR product was checked by...

Ngày tải lên: 07/03/2014, 04:20

... one of the 26 letters On the other hand, for handwriting input, each hi represents a sequence of 2-dimensional vectors that corresponds to the coordinates of the points of the keystroke Therefore, ... letter of a word Therefore, li represents one of the 26 letters As previously mentioned, for keyboard input, hi are discrete features whose values are also one of the 26 letters Therefore, p(hi ... and LER performance of synchronous HVR in different noise conditions The performance of synchronous HVR is shown in Table Compared to the results shown in Table 3, the WER performance of synchronous...

Ngày tải lên: 07/03/2014, 18:20

... Orientation Primer Sequence Amplicon Size Melt Temp GAPDH FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC GTGACTTCAACAGTGACACC CCTTGGAGGCCATGTAGACC ATCGAAGGGGACTTCCGCTG ... mix, 0.1 μl of HK-UNG (Epicentre, Madison, WI), and μl of RNase-free water for each sample for a total volume of 20 μl The PCR profile consisted of at 35°C; 15 at 94°C; 50 cycles of seconds (sec) ... content of the tissues between ACL-X and control joints for any of the regions tested Error bars indicate standard error of the mean Values are μg of HP/mg of tissue wet weight Differential gene expression...

Ngày tải lên: 20/06/2014, 00:20

... transformation zg = xg − μxg max abs xg − μxg , (1) where μxg represents the mean of xg 2.3 Extraction of Shape Information and Time Scaling To extract shape information of time-varying gene expression, ... vector of time points associated with gene g, zg is the vector of transformed time-series data (from (1)) associated with gene g, and yg is the resulting vector of first differences associated with gene ... parameters of the distribution Given the transformed expressions of G genes, y = [y1 , y2 , , yG ]T , the stated two tasks are equivalent to estimating K, the total number of clusters, and Cg for...

Ngày tải lên: 22/06/2014, 00:20

... effects As noted above, expression divergence (the extent to which expression of a gene evolves) correlates with expression responsiveness (the extent to which expression of a gene is changed in response ... evolvability of gene expression However, much is still unknown For example, the protein-DNA and protein-protein interactions that underlie the differential requirement of genes for general transcription ... evolvability of gene expression Science 2007, 317:118-121 38 Rando OJ, Verstrepen KJ: Timescales of genetic and epigenetic inheritance Cell 2007, 128:655-668 39 Raser JM, O’Shea EK: Noise in gene expression: ...

Ngày tải lên: 06/08/2014, 19:21

... with effects of both IFN-α/β and IFN-γ on gene expression In addition to this set of IFN-induced genes, gene expression profiles indicating ischemia and myofiber degeneration and regeneration were ... samples using the expression of a subset of genes; estimates accuracy of the gene panel on a prospective set CART: Salford Systems, http://www.salford-systems.com/ MART: Stanford University, http://www-stat.stanford.edu/~jhf/R-MART.html ... studies as a measure of diagnosis or clinical outcome [11] Microarray analysis of gene expression at sites of tissue damage The next generation of reports describing global gene expression patterns...

Ngày tải lên: 09/08/2014, 01:23

... CL: Discovery of distinctive gene expression profiles in rheumatoid synovium using cDNA microarray technology: evidence for the existence of multiple pathways of tissue destruction and repair Genes ... and prediction based on gene expression profiles Prediction of disease class is a major goal of microarray studies [18] Since gene expression patterns permit clustering of patients with autoimmune ... by the SLEDAI, reinforcing the hypothesis that the IFN signature is a measure of disease activity or severity [16] Inspection of gene expression data generated in our study of autoimmune subjects...

Ngày tải lên: 09/08/2014, 01:23

... limited number of genes Concordance or divergence of results can therefore be estimated only from the selection of genes published in more detail Up to now, gene expression profiling has given ... CL: Discovery of distinctive gene expression profiles in rheumatoid synovium using cDNA microarray technology: evidence for the existence of multiple pathways of tissue destruction and repair Genes ... collating of information and development of molecular network models will be essential and will provide the basis for functional interpretation Current status of gene expression profiling in...

Ngày tải lên: 09/08/2014, 01:23