integrands containing exponential functions of x and t

Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc

Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc

... and metastasis [36,37] Taken together, these findings suggest that inhibition of GnT-V might be useful in the treatment of malignancies by interfering with the metastatic process Fut8 Fut8 catalyzes ... target glycoprotein and that this competition between enzymes either positively or negatively regulates the biological function of the target protein Furthermore, these results suggest that competition ... modification of the a3-subunit may explain inhibition of GnT-V-induced cell migration by GnT-III [62] These results were the first to demonstrate that GnT-III and GnT-V competitively modify the same target...

Ngày tải lên: 18/02/2014, 17:20

10 477 0
Báo cáo hóa học: " Exponential convexity of Petrović and related functional" doc

Báo cáo hóa học: " Exponential convexity of Petrović and related functional" doc

... log t x1 r x1 − xi r−xi −ˆ n r−ˆxn x ⎪ ⎪ i=2 ⎪ ⎪⎛ ⎪ ⎞ ⎪ ⎪ x1 t x1 − n xi t xi −ˆ n t ˆxn t 1 ⎪ x ⎪ ⎪⎝ i=2 ⎪ ⎠ , t = r = 1, ⎨ n − log t x2 − x2 −ˆ xn i C4,2 (t, r; t ) = i=2 ⎛ ⎞ ⎪ n ⎪ ⎪ x2 t x1 ... log and exponentially convex functions and related results Example Let t Î ℝ and t : (0, ∞) ® ℝ be the function defined as t (u) = ut t 1 , t = 1, u log u, t = (18) Then t (u)/u is strictly ... x1 − x2 t −xi −ˆ t −ˆ n xn x ⎪ i ⎪ i=2 ⎪ exp ⎝ −1 − ⎠ , t = r, t, r = 1, ⎪ n ⎪ t log tt x1 t x1 − xi t −xi −ˆ n t −ˆ n x x ⎪ ⎪ ⎪ i=2 ⎞ ⎛ ⎪ n ⎪ ⎪ x3 − x3 −ˆ ⎪ i xn ⎪ i=2 ⎪ exp ⎝ ⎠, ⎪ t = r...

Ngày tải lên: 20/06/2014, 22:20

16 396 0
báo cáo khoa học: " Transcriptional regulatory programs underlying barley germination and regulatory functions of Gibberellin and abscisic acid" doc

báo cáo khoa học: " Transcriptional regulatory programs underlying barley germination and regulatory functions of Gibberellin and abscisic acid" doc

... measured The water content in germinating barley at each stage is indicated as Y axis as a percentage of the dry weight The representative time point of germination at each stage is indicated as X axis ... from their ancestor after 200 million years of independent evolution strongly suggests that those transcripts and pathways are functionally important to germination, and may contribute to the ... arabinogalactanlike protein, two glutaredoxin and three proteins with unknown functions The accumulation of the other 15 gene transcripts increased at S1 stage and reached the maximum level at S2 stage...

Ngày tải lên: 11/08/2014, 11:21

24 286 0
INVESTIGATION OF THE FUNCTIONS OF p23 AND COAT PROTEIN OF HIBISCUS CHLOROTIC RINGSPOT VIRU

INVESTIGATION OF THE FUNCTIONS OF p23 AND COAT PROTEIN OF HIBISCUS CHLOROTIC RINGSPOT VIRU

... transporting of intact virion via conjunction with the formation of tubular structures that are made of virusencoded MP and extend to the cytoplasm of adjacent uninfected cells (Kasteel et al., 1997; ... miRNAs and HCRSV infection, causing plant growth retardation 12 The results of the underlying mechanism between the interaction of HCRSV and kenaf may contribute to a better understanding of plant ... (2) The mixture in the tube was mixed by vortex and incubated at 65 °C water bath for 15 min, invert every (3) The tube of mixture was cooled to room temperature, µl βmercaptoethanol was added Then...

Ngày tải lên: 10/09/2015, 09:03

223 1,5K 0
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf

Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf

... membranes of the zymogen factor X, activated factor X (factor Xa) and the active site inhibited form DEGR-factor Xa as well as the the factor X peptides were studied with surface plasmon resonance The ... studies of the Ca2+-free form of the Gla-domain established that the metal ion binding translocated the residues that constitute the hydrophobic patch from the interior of the domain to the surface, ... allowing them to interact with the phospholipid membrane [7] Furthermore, these results support the notion that the nature of this drastic conformational transition must be highly cooperative with...

Ngày tải lên: 08/03/2014, 23:20

6 402 0
Báo cáo toán học: " Linear recurrences and asymptotic behavior of exponential sums of symmetric boolean functions" pptx

Báo cáo toán học: " Linear recurrences and asymptotic behavior of exponential sums of symmetric boolean functions" pptx

... behavior of exponential sums of symmetric boolean functions The correlation between two Boolean functions of n inputs is defined as the number of times the functions agree minus the number of times they ... associated to the exponential sum of F We prove that the coefficient of λ is not identically zero and obtain information about the spectrum of F (X1 , , Xn ) In particular, its limit is a periodic ... + x + x2 − x3 + x4 − x5 + x6 + x7 + x8 + x9 − x1 0 + x1 1 + x1 2 − x1 3 − x1 4 − x1 5 (4.28) Look at the sign of xj for j = 8, 9, · · · , 15 If xj and xj−8 have the same sign, then leave the sign of...

Ngày tải lên: 08/08/2014, 14:23

21 197 0
Investigations on the tissue distribution, localization and functions of brain enriched leucine rich repeats (LRR) containing proteins AMIGO AND ngr2

Investigations on the tissue distribution, localization and functions of brain enriched leucine rich repeats (LRR) containing proteins AMIGO AND ngr2

... CTG CCC GGG CTC CGG CGC CTG NgR2-RT-R GAT GGT GGA GAG GTT GTT GGA GAA GAG p75NTR-RT-F CAG ATG AAG CCA ACC ACG TG p75NTR-RT-R GCT GTT CCA TCT CTT GAA AGC AA TROY-RT-F AGT ATC ACC GGG ACT CAG TROY-RT-R ... endocytosis motif at the cytoplasmic tail that is not present in NLRR-2 The latter has instead a putative WW domain, a Chapter1 Introduction protein interaction motif binding to polypeptide stretches ... separate experiments Proportion of cells with different extent of neurite growth was calculated as percentage of total cells counted Statistical analysis and comparison between the populations...

Ngày tải lên: 08/11/2015, 17:08

144 276 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... especially adjectives It therefore seems that the semantic and syntactic function of adjectives are still too difficult for students So the writer researches the semantic and syntactic function of English ... adjectives with the hope that the writers graduation paper will contribute a small part on enriching the source of materials, and it hopes that students be able to further understand about semantic ... definitions of adjectives and their semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives Chapter IV...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... for inhibition test Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) oligonucleotide ... a total of with 30 s of incubation on ice between each burst Ethanol was added to the supernatant at a final concentration of 70% and extracted by shaking for 30 at room temperature After centrifuging ... Japan) To amplify the DNA fragments containing a complete x- 5 gliadin gene, oligonucleotides, 5¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based...

Ngày tải lên: 20/02/2014, 01:20

8 484 0
Tài liệu Báo cáo khoa học: A peptide containing a novel FPGN CD40-binding sequence enhances adenoviral infection of murine and human dendritic cells doc

Tài liệu Báo cáo khoa học: A peptide containing a novel FPGN CD40-binding sequence enhances adenoviral infection of murine and human dendritic cells doc

... of the input titer (Fig 1B) FPGN -containing peptides facilitate the uptake of adenovirus into CD40-expressing cells To test the ability of CD40-binding peptides in facilitating adenovirus entry ... percentage of GFP positive cells is shown Error bars represent the standard deviation of triplicate infections Results shown are representative of three experiments In both immature and mature ... expression of CD40 In fact, the amount of enhancement mediated by FPGN2-KBP in immature DC was similar to that of other cell types tested ( fourfold), suggesting that the level of CD40 on these...

Ngày tải lên: 20/02/2014, 11:20

8 458 0
Báo cáo khóa học: Characterization of Mesorhizobium huakuii lipid A containing both D-galacturonic acid and phosphate residues ppt

Báo cáo khóa học: Characterization of Mesorhizobium huakuii lipid A containing both D-galacturonic acid and phosphate residues ppt

... possible explanation due to the fact that numerous combinations of fatty acids different to those found in lipid A exist However, taking into consideration the quantities of lipid A fatty acids this ... °C The letters refer to the carbohydrate spin systems as was described in the text and shown in Table The numerals next to the letters indicate the protons in the respective residues Fig A partial ... p.p.m was attributed to inorganic phosphate impurities of the lipid A preparation The results of quantitative measurements of phosphorus and DAG content showed that no more than half of the lipid...

Ngày tải lên: 07/03/2014, 15:20

13 428 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... AtRPA70a-5¢ (TGT AACCGAGATGGTCGGCAAC) and AtRPA70a-3¢ (AA CAGTCATCTTCACTCTTTGT); AtRPA70b-5¢ (TTCAA CTTTGTACCCATTGAT) and AtRPA70b-3¢ (TTCACCG CCATTATATACCTTA) These primers were used to obtain ... primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b As a control, A thaliana putative 40S ribosomal protein S16 (At5g18380) was used ... OsRPA70a–OsRPA32–OsRPA14 extracts but most of it failed to bind to the GST column (Fig 4A), indicating that it could not interact with the OsRPA32 and OsRPA14 complex To confirm this selectivity, purified recombinant...

Ngày tải lên: 07/03/2014, 21:20

12 588 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

... corresponding to the mature peptide of MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) ... similarity and structural conservation of these genes and gene products, confirmation of the true identity and function of these neuropeptides remains difficult Unfortunately, most of these MIH-like peptides ... added to the explants, and the culture was incubated at 23–25 °C for h At the end of the culture period, the tissues were collected for total RNA extraction followed by northern blot hybridization...

Ngày tải lên: 16/03/2014, 05:20

11 546 0
Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf

Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf

... structure of the aY11 4T mutant was deter˚ mined at 2.0 A resolution (Table 2) The structure of the aY11 4T mutant was almost identical to that of the wildtype enzyme, except for the mutation site and the ... neither the cobalt content nor the catalytic activity was detectable The aT109S/aY11 4T double mutant showed characteristics similar to those of the aY11 4T mutant (data not shown) The crystal structure ... 0.71 Therefore, the structure of this mutant was almost identical to that of the wild-type enzyme, except for the mutation site Mutagenic analysis of aTyr114 To evaluate the effect of aTyr114...

Ngày tải lên: 16/03/2014, 16:20

10 510 0
The Practices and Functions of Customer Reference Marketing − Leveraging Customer References as Marketing Assets pptx

The Practices and Functions of Customer Reference Marketing − Leveraging Customer References as Marketing Assets pptx

... argumentation teams, and our goal is to quantify the benefits that the customer has received, but often, if the customer grants permission to use their name and gives a testimonial, then they don t want to ... well-established reputation However, the contextual effects that determine the relevance of the different functions of customer reference marketing are beyond the scope of this study Theoretical ... stories and reference visits or lists in that they involve more informal information exchange that cannot be totally controlled by the supplier It seems that the function of these types of practice...

Ngày tải lên: 23/03/2014, 03:20

20 404 0
Báo cáo khoa học: Extraenzymatic functions of the dipeptidyl peptidase IV-related proteins DP8 and DP9 in cell adhesion, migration and apoptosis doc

Báo cáo khoa học: Extraenzymatic functions of the dipeptidyl peptidase IV-related proteins DP8 and DP9 in cell adhesion, migration and apoptosis doc

... of the three DP9 constructs The extent of increased apoptosis among DP9-expressing cells was similar to the extent of the adhesion deficit This concordance of apoptosis and adhesion suggests that ... enzyme activity or the RGD motif Interestingly, even without STS treatment there were increases of about 20–25% in the percentages of apoptotic cells in the cell subpopulations that were overexpressing ... integrin-binding motif, but it is difficult to envisage a role for this motif on a cytoplasmic protein In this first investigation of DP8 and DP9 nonenzymatic functions, the hypothesis that DP8 and...

Ngày tải lên: 23/03/2014, 11:20

14 280 0
Charity Law & Social Policy National and International Perspectives on the Functions of the Law Relating to Charities pptx

Charity Law & Social Policy National and International Perspectives on the Functions of the Law Relating to Charities pptx

... entitlement to tax exemption or on supporting an authentically independent charitable sector, the extent to which it provides protection for donors and the importance it attaches to adjusting the application ... charity represents both public and private interests It considers the features that differentiate charity from other forms of not-for-profit entities and identifies the range of legal structures that ... what constitutes a gift and who is entitled to receive it; in protecting the value of the gift; and in supporting and regulating the proper and efficient functioning of the relationship It is the...

Ngày tải lên: 29/03/2014, 05:20

623 524 0
handbook of x ray spectrometry revised and expanded by rene van grieken

handbook of x ray spectrometry revised and expanded by rene van grieken

... (6.0225261023 atoms=g atom) The mass attenuation coefficient m (cm2=g) is the ratio of the linear attenuation coefficient and the density of the material It is worth mentioning that the absorption coefficient is ... G ð90Þ The enhancement effect, consisting of an extra excitation of the element of interest by the characteristic radiation of some matrix elements, modifies the equations for the intensity Ii ðEi ... performance and in further extensions of the applicability range of xray spectrometry Consequently, most of the authors who contributed to the first edition of this book enthusiastically accepted the...

Ngày tải lên: 10/04/2014, 18:53

985 1,6K 0
Methods to access quality and stability of oils and fat  containing foods

Methods to access quality and stability of oils and fat containing foods

... endpoint of a buttery intensity scale Regardless of the product used, it is important that the selected reference clearly illustrates the attribute that it was meant to represent, and that it is stable ... light stability at room temperature and 75 ft-candles/ft2 (705 lux) of cool white florescent light However, the extracted oil had better initial heat stability at 180°C, giving 14.1 hr of OSI stability ... beginnings of current methods for analysis were then present The American Meat Institute was evaluating the Swift Stability Test for lards—the precursor of the current fat stability, Active Oxygen Method...

Ngày tải lên: 23/05/2014, 12:34

219 1,5K 1
w