initial mathematics teacher education
The Professional Education and Development of Teachers of Mathematics
... generalist teacher education and specialized mathematics teacher education This divide is most often facilitated along a divide between elementary teacher education and secondary mathematics teacher education. 1 ... the initial teacher experience to form a unified fibre, the content of which is teacher knowledge 1.1.2 Components of Mathematics Teacher Training 31 Fig 1.1.2.1 Teacher knowledge in initial teacher ... Viewing mathematics teachers’ beliefs as sensible systems Journal of Mathematics Teacher Education, 9(2), 91–102 Lerman, S (2001) A review of research perspectives on mathematics teacher education...
Ngày tải lên: 13/02/2015, 06:00
Aaron r bradley programming for engineers a foundational approach to learning c and matlab
... the possibility of unintentionally using uninitialized memory, but it won’t crash the program One method to avoid using uninitialized memory is to initialize variables at declaration: { int a ... to find reasonable values to which to initialize variables, and one can still unintentionally use the initializing value when another value was intended But initializing variables at least avoids ... int ** y ; y = &x; *y = &a; ** y = 1; } The initial memory configuration is as follows: int ** y ⊗ 1008 int * x ⊗ 1004 int a ⊗ 1000 All memory cells initially contain garbage, that is, whatever...
Ngày tải lên: 19/03/2014, 14:05
Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps
... ultimately this infection is lethal due to long-term failure to clear the organism [6,7] In the initial phase of infection, Listeria binds to splenic macrophages and is internalized; Listeria ... microbial products However, RAGE ligands inducibly expressed upon macrophage activation may potentiate initial innate activation and the systemic inflammatory response It is well established that in ... lymphocytes is Page of (page number not for citation purposes) critical for macrophage activation and initial bacterial clearance as well as for promotion of long-term protective cellular immunity [10]...
Ngày tải lên: 13/08/2014, 10:20
membrane technology a practical guide to membrane technology and applications in food and bioprocessing
... their spouses Chuck Harris and Nupur Parikh and his two lovely grandchildren Reya and Azad; all his teachers and mentors during his entire career; and his parents who would have been both excited ... critical flux In such conditions, the lower flux results in a need for larger membrane area, but the initial investment is overcome by sustained reduced operating costs (lower pressure results in lower ... viscosity, tomato is processed hot, at 65À70 C The applied pressure can be up to 60 bar, but initial pressures are lower This is because the membranes suffer irreversible fouling resulting...
Ngày tải lên: 02/04/2014, 15:04
báo cáo hóa học:" Keeping health staff healthy: evaluation of a workplace initiative to reduce morbidity and mortality from HIV/AIDS in Malawi" pot
... A, Hargreaves N, Gausi F, Kwanjana K, Salaniponi J: High death rates in health care workers and teachers in Malawi Transact Royal Soc Trop Med & Hyg 2002, 96:34-37 Huddart J, Picazo O: The Health...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo lâm nghiệp: " Release of oxalate and protons by ectomycorrhizal fungi in response to P-deficiency and calcium carbonate in nutrient solution" pptx
... Faraday cage by inserting both electrodes to a depth of mm The pH was measured directly above the initial plug and at 0.5 cm intervals to the edge of the dish 2.5 Statistics All results given are ... studied isolates produced different effects on final pH value of the nutrient solution that was initially set at 5.2 (Fig 2) Both H cylindrosporum isolates Oxalate release by ectomycorrhizal fungi...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo y học: "Decreased response to IL-12 and IL-18 of peripheral blood cells in rheumatoid arthritis" doc
Ngày tải lên: 09/08/2014, 01:23
Báo cáo khoa học: " The effects of ectomycorrhizal status on carbon dioxide assimilation capacity, water-use efficiency and response to transplanting in seedlings of Pseudotsuga menziesii (Mirb) Franco" docx
... been established for transplanted Cedrus atlantica seedlings that the recovery of A, following the initial phase of decline, was concomitant with root regeneration The results obtained here (figs...
Ngày tải lên: 09/08/2014, 03:25
báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx
... [17] We next analyzed the expression of a few key chlorophyll biosynthesis genes in tspo-1 plants Initially, we determined the mRNA levels of most of the key genes in the tetrapyrrole pathway (Additional...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " The Chinese government’s response to drug use and HIV/AIDS: A review of policies and programs" potx
... of peer education on AIDS knowledge among withdrawal members after compulsory detoxification Chinese Journal of Health Education 2008, 24:578-580 57 Luo J, Yang F, Li HJ, Zhu H: Peer education ... programs [56,57] Large-scale peer education programs have not been conducted [58] Therefore, the government should not only support for the development of a national education program, but create ... budget plan Available literatures show that peer education plays an effective role in the harm reduction programs [54,55] Page of Although peer education has been conducted successfully in a number...
Ngày tải lên: 11/08/2014, 18:20
báo cáo khoa học: " Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments" ppt
... of each primer, and units of Platinum Pfx polymerase (Invitrogen) The PCR conditions included an initial denaturation at 94°C for min, followed by 35 cycles of 94°C for 30 s, 50°C for 30 s, 68°C ... file and the adaptor sequence was 5'-GACTCGAGCGACATCGAT-3' [125] The PCR conditions included an initial denaturation of 94°C for min, followed by 35 cycles of 94°C for 30 s, 50°C for 30 s, 72°C...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: "Serum levels of autoantibodies against C-reactive protein correlate with renal disease activity and response to therapy in lupus nephritis" pps
... classical activation, however, CRP-mediated activation appears to be essentially limited to the initial stages involving C1 to C4, with less formation of the membrane attack complex [13] Furthermore, ... (n = 27) or orally (n = 1), rituximab (n = 6), and mycophenolate mofetil (n = 3) One patient was initially treated with mycophenolate mofetil, but switched to intravenous cyclophosphamide after...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMp" doc
... CTTGGCGATGTAGGCGATAAGGTCGA 20 FksA AFUA_6G12400 GCTGCGCCCAAG*TCGCCAAATC 40 GAACAACAAGTGGGGCAATG 20 As part of the initial work up for these experiments primer concentrations were optimized so that all allergens...
Ngày tải lên: 13/08/2014, 13:22
REGULATION OF CHOP TRANSLATION IN RESPONSE TO eIF2 PHOSPHORYLATION AND ITS ROLE IN CELL FATE
... apoptosisinducing factors, such as NADPH oxidase subunit Nox2, JNK, Fas and STAT1 (153) While the initial induction of CaMKII is ERO1α independent, the ERO1α sustains the CaMKII activity (155) CHOP...
Ngày tải lên: 24/08/2014, 12:32
lichen response to the environment and forest structure in the western cascades of oregon
Ngày tải lên: 14/11/2014, 07:22