information in a dental record
Release of anti-cyanobacterial allelochemicals from aquatic and terrestrial plants applicable for artificial floating islands
Ngày tải lên :
05/09/2013, 09:38
... natural to expect that vegetation used in artificial floating islands may also cause allelopathic growth inhibition of cyanobacteria In fact, some papers reported the existence of anticyanobacterial ... plant extracts These findings indicates the possible release of anti-cyanobacterial compounds from vegetation in artificial floating islands, and such allelopathic vegetation may be used in artificial ... 133-138 Hayashi, N., M Takayanagi, T Kuwabara, and Y Inamori (2003) Strategy on spreading the floating type edible aquatic plant purification system to developing countries J of Water and Waste,...
- 9
- 494
- 0
Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx
Ngày tải lên :
16/02/2014, 14:20
... Matrilysin (matrix metalloproteinase-7): a new promising drug target in cancer and in ammation? Cytokine Growth Factor Rev 15, 111–115 36 Nagashima Y, Hasegawa S, Koshikawa N, Taki A, Ichikawa ... collagens, gelatin, laminin, and plasminogen [2] MMP-12 (macrophage elastase) is expressed mainly by macrophages The enzyme cleaves a variety of substrates, including collagens, gelatin, laminin, pro-tumor ... family, does not contain a hemopexin-like domain and acts only with its catalytic domain, and MMP-12 is special in that it autocatalytically loses its hemopexin-like domain soon after activation...
- 18
- 428
- 0
Tài liệu Báo cáo khoa học: "The Second Release of the RASP System" pdf
Ngày tải lên :
20/02/2014, 12:20
... gain in parse accuracy as well as coverage (Watson, 2006) 2.3 Morphological Analysis The morphological analyser is also implemented in Flex, with about 1400 finite-state rules incorporating a ... This makes the system more easily retrainable after changes in the grammar and opens up the possibility of quicker tuning to in- domain data In addition, the structural ranking induced by the parser ... 3: Accuracy on DepBank Inui, K., V Sornlertlamvanich, H Tanaka and T Tokunaga (1997) A new formalization of probabilistic GLR parsing’, Proceedings of the 5th International Workshop on Parsing...
- 4
- 498
- 0
Báo cáo khoa học: Cyclic ADP-ribose requires CD38 to regulate the release of ATP in visceral smooth muscle ppt
Ngày tải lên :
05/03/2014, 23:20
... ADPR + cADPR β-NAD + ADPR + cADPR Ado ADP 12 AMP ATP 14 Ado ADP AMP ATP 10 ADP ATP ST, BoNTA Ado β-NAD + ADPR + cADPR 100 LU AMP ATP Ado AMP ATP AMP ADP L Durnin and V N Mutafova-Yambolieva 16 18 ... bladder A B CD38+/+ PS β-NAD + ADPR + cADPR Ado ATP AMP β-NAD + ADPR + cADPR ST Ado β-NAD + ADPR + cADPR 100 LU ADP AMP ATP AMP ATP ST Ado ADP ADP Ado ADP AMP ATP ST, TTX ST, TTX β-NAD + ADPR + cADPR ... 3097 cADPR and CD38 modulate ATP release in the bladder B CD38+/+ A PS CD38–/– PS β-NAD + ADPR + cADPR β-NAD + ADPR + cADPR ADP Ado ADP ATP ST β-NAD + ADPR + cADPR ST Ado AMP ST, BoNTA β-NAD + ADPR...
- 14
- 509
- 0
Color Atlas of Dental Medicine: Aesthetic Dentistry pdf
Ngày tải lên :
06/03/2014, 12:21
... and -APS system cameras (Advanced Photo System) Instant Camera (Polaroid System) In certain situation, instant cameras have their advantages, for example, if neither an intraoral camera nor a digital ... Abnormalities of the Chin Bilateral Horizontal Mandibular Hyperplasia Vertical Maxillary Hyperplasia Vertical Maxillary Hyperplasia, Mandibular Retrognathia, and Nasal Deformation Orthognathic ... further alloys with advantages for aesthetics and biocompatibility Since titanium has served as a framework material, dental ceramic masses to cover this metal have also been available The advantages...
- 307
- 1.5K
- 4
Extent of Dental Disease in Children Has Not Decreased, and Millions Are Estimated to Have Untreated Tooth Decay pptx
Ngày tải lên :
14/03/2014, 09:20
... contain more information on our NHANES and MEPS analyses Finally, we obtained information on oral health and the Medicaid population from CDC and from dental associations and experts including ... MEPS— administered by HHS’s Agency for Healthcare Research and Quality (AHRQ)—obtains nationally representative information on Americans’ health insurance coverage and use of health care, including ... dental care from his Medicaid managed care organization, Deamonte’s family had experienced significant difficulties in obtaining needed dental care, including finding a dentist in their Maryland...
- 46
- 443
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
Ngày tải lên :
16/03/2014, 01:20
... pcDNA3.1-HSP70DPBD Sense of pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG ... GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC TCGGGTACCGGATCTACCTCCTCAATGGTG FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS 2621 ATP-binding ... ATP-binding domain of HSP70 inhibits Smac release B Jiang et al mitochondrial protein, second mitochondria-derived activator of caspase (Smac, also known as DIABLO), is released into the...
- 10
- 726
- 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot
Ngày tải lên :
16/03/2014, 06:20
... ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA ... AK LF AK SF AK LR AK SR eIF 4A LF eIF 4A SF eIF 4A LR eIF 4A SR CAATCCATCAAAACCGTGTG TGCTACAGCAACTGGTGATCAGAAGGG CCCTTCCTGATCACCATGTTGCTGT GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ... a more than 30-fold increase in lactate, whereas the levels in controls remained constant The arginine kinase gene (AK) and the eukaryotic translation initiation factor 4A gene (eIF 4A, DQ667140)...
- 12
- 474
- 0
Báo cáo Y học: Permeability transition-independent release of mitochondrial cytochrome c induced by valinomycin ppt
Ngày tải lên :
17/03/2014, 10:20
... inhibitors CsA and BKA As shown in Fig 1A, Ca2+ gradually accelerated the mitochondrial respiration with succinate as a substrate (upper trace b), as well as mitochondrial swelling (lower trace b), and ... increased mitochondrial respiration with no accompanying swelling, and CsA and BKA were ineffective in preventing accelerated respiration (Fig 1B) In contrast, as shown in Fig 1C, valinomycin accelerated ... protein)1Æmin)1) than the liver mitochondria (data not shown) When valinomycin was added to the brain mitochondria, CsA-insensitive acceleration of respiration was observed (data not shown), indicating...
- 7
- 272
- 0
Aesthetic Groundwater Quality Impacts from a Continuous Pilot-Scale Release of an Ethanol Blend pptx
Ngày tải lên :
30/03/2014, 16:20
... (NaBr) was injected at a depth of 22.5 cm below the water table at a rate of 0.4 L/d The NaBr was added as a conservative tracer, and to maintain a solution density to reach a neutral buoyancy ... B.S Lollar, F Pearson, L Balser, and D.M MacKay 2008 Comparative assessments of benzene, toluene, and xylene natural attenuation by quantitative polymerase chain reaction analysis of a catabolic ... References Alvarez, P.J., and W .A Illman 2005 Bioremediation and Natural Attenuation: Process Fundamentals and Mathematical Models Hoboken, New Jersey: Wiley-Interscience Atlas, R.M., and R Bartha 1993...
- 8
- 413
- 0
in vitro release of ketoprofen from proprietary and extemporaneously manufactured gels
Ngày tải lên :
13/04/2014, 09:25
... signalling, emotions expressed), as well as a factor in xenophobia and bias against fellow humans that has shaped the destiny of humanity (12, 15, 16) The skin also serves as a barrier against ... body of living animals or humans (36) The skin acts as a barrier to maintain the internal milieu, however, it is not a total barrier and many chemicals have been shown to penetrate into and through ... anti-inflammatory and analgesic activities Although ketoprofen is rapidly absorbed, metabolized and excreted, it causes some gastrointestinal complaints such as nausea, dyspepsia, diarrhoea, constipation...
- 222
- 693
- 0
Báo cáo hóa học: " Involvement of intracellular free Ca2+ in enhanced release of herpes simplex virus by hydrogen peroxide" ppt
Ngày tải lên :
20/06/2014, 01:20
... 67:921-932 Oyama Y, Okazaki E, Chikahisa L, Nagano T, Sadakata C: Oxidative stress-induced increase in intracellular Ca2+ and Ca(2+)induced increase in oxidative stress: an experimental model using dissociated ... identified fura-2-loaded cells using alternating excitation wavelengths (340 and 380 nm) with an AQUACOSMOS ratio imaging application software (HAMAMATSU Photonics, Hamamatsu, Japan) and an inverted ... Linxe C, Quero AM, Geniteau-Legendre M, Servin A: Rotavirus infection induces an increase in intracellular calcium concentration in human intestinal epithelial cells: role in microvillar actin...
- 9
- 443
- 0
báo cáo hóa học:" Hind-foot correction and stabilization by pins in plaster after surgical release of talipes equino varus feet in older children" pot
Ngày tải lên :
20/06/2014, 04:20
... the lateral view, the preoperative talo-calcaneal angle ranged from 0°-14° (parallelism of the talus and calcaneus), with a mean of 5° The lateral tibio-calcaneal angle was always an acute angle ... wires, and at the final follow-up period The anteroposterior (AP) talo-calcaneal angle, (Kites angle), the AP talus -first metatarsal angle, the lateral tibio-calcaneal angle, and the lateral talo-calcaneal ... study In the sagittal plane, the pin should be in line with the first metatarsal This pin was used as a joystick to rotate the talar body internally while the navicular was pushed into abduction and...
- 8
- 282
- 0
Báo cáo hóa học: "Sustained release of VEGF from PLGA nanoparticles embedded thermo-sensitive hydrogel in full-thickness porcine bladder acellular matrix" doc
Ngày tải lên :
21/06/2014, 04:20
... oral administration: an in vitro physico-chemical characterization J Biomed Nanotechnol 2009, 5: 45-53 Aggarwal S, Yadav S, Gupta S: EGFR targeted PLGA nanoparticles using gemcitabine for treatment ... of this paper haven’t hold any stocks or shares in any organizations that may in any way gain or lose financially from the publication of this manuscript All the authors of this paper haven’t hold ... nanopharmaceuticals in China Nano Biomed Eng 2009, 1: Tian F, Prina-Mello A, Estrada G, Beyerle A, M ller W, Schulz H, Kreyling W, Stoeger T: Macrophage cellular adaptation, localization and imaging of...
- 8
- 311
- 0
Báo cáo hóa học: " The Effect of Single, Binary and Ternary Anions of Chloride, Carbonate and Phosphate on the Release of 2,4-Dichlorophenoxyacetate Intercalated into the Zn–Al-layered Double Hydroxide Nanohybrid" pot
Ngày tải lên :
22/06/2014, 00:20
... micrographs were obtained In the single system release media, it could be observed that carbonate dominated the accumulated release Table Basal spacing and elemental analysis of Zn–Al-LDH (ZAN) and ... where at low concentration it can act as an auxin analogue, promoting plant growth but lethal to plants at high concentrations Therefore, 2,4-D is also used as an herbicide against broad-leafed and ... Fitting the data of the release of 2,4-D from the interlamellae of ZANDI, the nanohybrid into various aqueous solutions systems containing single, binary and ternary anions: chloride (a) , carbonate...
- 7
- 459
- 0
assess the efficiency of dental plaque control in decay teeth, gingivitis prevention for the 12 years- old pupils at some schools in the suburb of hanoi
Ngày tải lên :
25/07/2014, 13:57
... beverages (n=1022) Index Amount Scale (%) Number of time of eating, drinking sweet food and beverage and beverages each day: - Many times 703 68.8 Oral and dental hygience after eating, drinking ... 3.1 Reality of decay teeth, gingivitis, dental plaque, knowledge, attitude, practice about oral and dental care and some factors related to oral and dental diseases for the pupils 3.1.1 Reality ... found that there were 500 species of different bacteria in the dental plaque The dental plaque was considered as the most important exotic agent in the oral and dental diseases The dental plaque...
- 29
- 360
- 0
Báo cáo lâm nghiệp:"Long-term effects of vegetation control treatments for release of Engelmann spruce from a mixed-shrub" pdf
Ngày tải lên :
08/08/2014, 01:21
... Simard and Heineman [44] found chemical and manual treatments ineffective in a willow dominated site Heavy rain soon after application may have affected herbicide efficacy and the cover was marginally ... balsamifera ssp trichocarpa (T & G.) Brayshaw) (Tab III) The LSD pairwise comparison test indicate that single manual cutting (treatment a and b), repeated manual cutting (treatment d, e and f), and ... significant differences in spruce survival appeared five-years after treatment application and continued thereafter (Fig and Tab IV) Polynomial contrasts indicate that both manual cutting (single and...
- 10
- 264
- 0
Báo cáo lâm nghiệp: " Release of oxalate and protons by ectomycorrhizal fungi in response to P-deficiency and calcium carbonate in nutrient solution" pptx
Ngày tải lên :
08/08/2014, 01:21
... 1C) 3.2 Oxalate production and calcium content Analysis of organic anions extracted from the mycelia or accumulated in culture solution showed that oxalate was always the main organic anion (> ... with minor quantities of citrate, succinate, malate and tartrate (data not shown) Measurements of total oxalate amounts, corresponding to the sum of the amount excreted in Figure Final pH values ... as Pi + CaCO3 medium, contained 500 µM NaH2PO4 and g·L–1 of CaCO3 solid phase instead of CaCl2 The mineral was a reagent grade commercial product (Merck 2066) and was added to each flask before...
- 7
- 311
- 0
Báo cáo khoa học: "The role of photoperiod and temperature in the induction and the release of dormancy in Pinus sylvestris L. seedlings" potx
Ngày tải lên :
09/08/2014, 02:21
... Dormancy breaking treatments of and wk had a dramatic influence, hastening the tilushing rate, especially in the plants with lowest degree of dormancy In Fig the same reactions to temperature and ... Lang (1987): &dquo;Dormancy is the temporary sus- different temperature dormancy inducing regimes treatment used as a Seedlings were was grown in pots with mineral wool as a substrate and watered ... For that reason, deep dormancy will be used as the definition of the most dormant stage obtained There are no strict borderlines to phases before and after deep dormancy Early and late phases...
- 5
- 318
- 0