indispensable roles of cyclooxygenase 1 and 2 in endothelium dependent contractions

... ,T otomakO ,Z gnaT ,EP rerehcS ,SK gnoS 41 422 - 12 2 , 62 ,69 91 seR teV J naeroK aniter kcud eht no dica ciniak fo stceffE M miK ,T nihS 31 02 -11 ,5 61 ,50 02 lonummiorueN J sitileymolahpecne enummiotua ... ,FH hsidoL ,I otomihsiN ,M nuhC ,T otomakO ,EP rerehcS 11 643 92 -733 92 ,27 2 ,79 91 mehC loiB J oviv ni xelpmoc ciremogilo -oreteh elbats a mrof dna ezilacol-oc dna sniloevaC 2- niloevac fo noisserpxe ... eht ni 3- dna ,2- ,1- niloevac fo noisserpxE Y otomustaM ,N amunaT ,M nhA ,C nooM ,KJ niJ ,H miK ,T nihS 21 5 31- 1 31 ,39 ,69 91 ASU icS dacA ltaN corP ylimaf eneg niloevac a senifed 2- niloevac fo...

Ngày tải lên: 07/08/2014, 18:21

... functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of HDAC 20 1. 11 Biological effects and ... effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy 23 1. 11. 4 Anti-angiogenesis, ... Anti-angiogenesis, anti-metastasis and invasion 24 1. 11. 5 Anti-tumor immunity 25 1. 12 HDAC inhibitors in cancer therapy 26 1. 12 .1 Clinical trials 26 1. 12. 2 Synergism with other...

Ngày tải lên: 10/09/2015, 08:27

... Biochem 2 71) 20 53 Rsk-mediated phosphorylation of Bad Ser 1 12 [29 ] Moreover, in murine brain, TGFb1 protected against ischemia while activating ERK1 /2 and increasing Bad phosphorylation at Ser 1 12 [29 ] ... Ó FEBS 20 04 28 29 30 31 32 33 34 35 36 37 38 39 40 41 Role of ERK1 /2 in neuronal survival (Eur J Biochem 2 71) 20 55 fructose -1, 6-bisphosphate during hypoxia involves intracellular Ca2+ and phospholipase ... Watson, S.P (19 98) Direct inhibition of cyclooxygenase- 1 and -2 by the kinase inhibitors SB 20 3580 and PD 98059 SB 20 3580 also inhibits thromboxane synthase J Biol Chem 27 3, 28 766 28 7 72 Pereira,...

Ngày tải lên: 30/03/2014, 14:20

... (mycoside B) 20 10 12 80 13 60 14 40 15 20 40 30 20 10 16 00 Mass (m/z) 12 80 15 02. 62 14 18. 52 14 32. 54 14 46.55 14 60.57 14 74.59 13 90.49 13 48.44 13 62. 46 13 76.47 50 13 60 14 40 15 16.64 30 60 BCG WT DIM A 14 88.60 ... 14 04. 51 50 80 13 06.39 13 20 .40 13 34. 42 60 90 14 88.47 13 90.36 14 04.37 14 18.39 70 13 48. 31 13 62. 33 13 76.34 Intensity (%) 80 10 0 Intensity (%) 90 PMM137:pM26D DIM A 15 02. 48 10 0 15 16. 52 C 14 32. 40 14 46. 42 ... 19 48 19 90.50 40 19 62. 46 50 20 20 85.4 19 34. 42 19 48.44 19 06.38 60 H37Rv:pPET1 PGL-tb 20 04.53 2 018 .54 30 70 18 50.33 18 64.33 18 78.35 18 92. 37 40 18 22 .69 18 36.70 18 50. 71 1864.73 18 78.75 18 92. 76 60 Intensity...

Ngày tải lên: 15/03/2014, 11:20

... tneicifed -1- niloevaC PM itnasiL ,GP knarF ,MT smailliW ,SG nassaH 711 1 -11 11 , 91 ,10 02 locnO nilC J 7059 lairT puorG ygolocnO 313 yparehT noitaidaR fo stluser :emrofitlum amotsalboilg rof noitaidar lainarc ... ,KJ niJ ,H miK ,T nihS 61 51- 01 ,3 32 ,60 02 tteL recnaC amoleym elpitlum ni tegrat cituepareht wen laitnetop a sa 1- niloevaC CK nosrednA ,K radoP 51 22 45- 914 5 ,3 72 ,89 91 mehC loiB J enarbmem amsalp ... senilediug HIN eht ni dnuof sa ,erac dna esu lamina yrotarobal rof selpicnirp detpecca yllanoitanretni eht htiw ecnadrocca ni detcudnoc saw hcraeser ehT Co 32 ta elcyc krad h- 21 : thgil h- 21 a no deniatniam...

Ngày tải lên: 07/08/2014, 18:21

... diffusely infiltrating gliomas of the WHO grades II and III and in secondary GBM but only in around % of primary GBM (11 ;18 -22 ) In our series we identified in of 14 0 patients (3 %) IDH -1 mutations ... Science 20 08;3 21 : 1807 - 12 21 Watanabe T, Nobusawa S, Kleihues P, Ohgaki H IDH1 mutations are early events in the development of astrocytomas and oligodendrogliomas Am J Pathol 20 09 ;17 4 :11 49-53 22 Yan ... Anti-seizure medication – no (%) yes no 66 ( 41) 94 (59) Sex – number (%) 11 5 ( 72) 45 (28 ) 43 (27 ) 51 ( 32) 66 ( 41) 33 ( 21 ) 90 (56) 37 (23 ) 24 7-98 11 3 ( 71) 47 (29 ) 75 (47) 85 (53) Figure Figure Figure...

Ngày tải lên: 09/08/2014, 09:21

... pandemic H5N1 influenza virus in eastern Asia Nature 20 04, 430(6996) :20 9- 21 3 WHO: Evolution of H5N1 avian influenza viruses in Asia Emerg Infect Dis 20 05, 11 (10 ) :15 15 -15 21 Smith GJ, Naipospos TS, ... reaction was conducted in a total volume of 25 μl containing 12 .5 μl of 2 RT-PCR Reaction Mix, 400 nM of each primer, 12 0 nM of probe, 0.5 μl of iScript Reverse Transcriptase, and μl of template Optimized ... detecting 10 copies of ssDNA plasmid, and less than 0.5 PFU of H5N1 viruses per reaction, and specific for the detection of influenza A of subtype H5 The HA gene of clades 1, 2 .1, and 2. 3 was...

Ngày tải lên: 12/08/2014, 04:21

... Product length (bp) Position of amplified DNA (bp) cav -1 Z46 614 .1 123 25 14 7 cav -1 Z46 614 .1 1 21 165 28 5 cav -2 BC0 620 59 .1 106 3 92 497 cav -2 BC0 620 59 .1 127 17 6–3 02 β-MG NM_ 0 12 5 12 Forward: CAGCATGTCTGGGGGTAAAT ... Caveolin -1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities J Biol Chem 20 01, 27 6:3 8 12 1-3 813 8 22 23 24 25 26 27 28 29 30 31 32 33 34 Drenckhahn D, Hofmann ... expression of distinct mRNAs J Biol Chem 20 04, 27 9 :25 574 -25 5 81 Norkin LC: Caveolae in the uptake and targeting of infectious agents and secreted toxins Adv Drug Deliv Rev 20 01, 49:3 01- 315 Norkin LC, Anderson...

Ngày tải lên: 12/08/2014, 16:20

... 1. 2. 2.3 DNA-binding domain 11 1. 2. 2.4 Linker domain 12 1. 2. 2.5 SH2 domain 13 1. 2. 2.6 STAT tyrosine phosphorylation 13 1. 2. 2.7 Transactivation domain 14 1. 3 STAT signaling pathway 15 ii 1. 3 .1 JAK-STAT ... 1. 10 .1. 2 Pin1 and p53, p73 tumor suppressor 39 iii 1. 10 .2 Pin1 in Alzheimer’s disease 40 1. 10.3 Pin1, cyclin D1 and breast cancer 41 1 .10 .3 .1 Pin1 and cyclin D1 upregulation 41 1 .10 .3 .2 Pin1 in ... 1. 1 Signal transduction in mammalian cells 1. 2 STAT family proteins 1. 2 .1 Isolation of STAT genes 1. 2. 2 Functional domains of STATs 1. 2. 2 .1 N-terminal domain 1. 2. 2 .2 Coiled-coil domain 10 1. 2. 2.3...

Ngày tải lên: 15/09/2015, 17:10

... concentration of interferon was determined http://www.virologyj.com/content/4 /1/ 89 10 11 12 13 14 15 16 17 18 19 20 Competing interests The author(s) declare that they have no competing interests 21 Acknowledgements ... were obtained with 17 -1, 17 -2 and 17 -3 (Fig 6B) and 24 -1, 24 -2, 24 -3 (Fig 6C) The receptor binding studies were also confirmed by examining expression of interferon receptors using protein lysates ... well in the presence of interferon alpha Individual clones were picked and nine different stable cell lines from each low inducer replicon [Con -15 (15 /1, 15 /2, 15 /3), Con -17 (17 /1, 17 /2, 17 /3) and...

Ngày tải lên: 18/06/2014, 18:20

... expression of maspin in ovarian carcinoma Clin Cancer Res 20 02, 8 :29 24 -29 32 doi :10 .11 86 /17 56-9966-30- 31 Cite this article as: Lin et al.: Expression of Ets -1, Ang -2 and maspin in ovarian cancer and ... Ets -1 Maspin Ang -2 P p 11 0.553 0.5 82 0.703 50~ serous Pathological diagnosis p < 50 age 19 12 0.6 51 0 .19 3 0.508 0 .19 7 0 .16 0 0.588 0. 916 0.3 42 0.498 0 .26 8 0. 916 0. 022 0. 824 0 .20 9 mucous grade others ... cell Biol 20 09, 29 :2 011 -20 22 11 Tse V, Xu L, Yung YC, Santarelli JG, Juan D, Fabel K, Silverberg G, Harsh G: The temporal-spatial expression of VEGF, angiopoietin -1 and 2, and Tie2 during tumor...

Ngày tải lên: 10/08/2014, 10:21

... http://genomebiology.com /20 07/8 /1/ R14 R14 .10 Genome Biology 20 07, 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 Volume 8, Issue 1, Article R14 Toscano et al Resting and arecoline-stimulated brain ... factor -1. 84 -1. 52 BG0784 82 Synaptotagmin binding, cytoplasmic RNA interacting protein 1. 67 1. 84 BG079093 Glycolipid transfer protein 2. 26 2. 02 BG0 819 77 THAP domain containing 11 -1. 85 -1. 94 BG083840 ... diphosphohydrolase -1. 84 -1. 94 BG0646 31 Timeless homolog (Drosophila) 1. 95 reviews Hippocampus 1. 81 2. 09 RNA binding motif, single stranded interacting protein 1. 52 Ubiquitin A- 52 residue ribosomal protein fusion...

Ngày tải lên: 14/08/2014, 17:22

... specification of midbrain dopamine neurons Radial glia cells are neuronal progenitors in vivo 10 11 14 1. 3 Long non-coding RNAs in biology 15 1. 3 .1 1.3 .2 1. 3 .2 .1 1.3 .2. 2 1. 3 .2. 3 Long non-coding RNAs in ... (NM_0 020 46.3) HES5 (NM_0 010 10 926 .3) HB9 (NM_005 515 .3) ISLET1 (NM_0 022 02. 2) LMX1A (NM _17 7398 .2) LMX1B (NM_0 02 316 .2) LRRN3 (NM_ 018 334.4) MAP2 (NM_0 023 74.3 NM_0 318 45 .2 NM_0 318 47 .2 NM_0 010 39538 .1) MBP ... modular scaffold 10 1 10 1 6.4 Conclusion 10 4 Chapter VII: Long Non-coding RNAs are Indispensable in Neurogenesis 10 5 7 .1 Introduction 10 5 7 .2 Results 10 7 7 .2 .1 7 .2. 2 7 .2. 3 7 .2. 4 Screening for possibly...

Ngày tải lên: 09/09/2015, 17:54

Ngày tải lên: 09/09/2015, 17:54

... satellites 10 iv 1. 2. 2 Components of MTOCs 10 1. 2. 2 .1 The γ-TuRC 10 1. 2. 2 .2 Mto1p and Mto2p 12 1. 2. 3 Organizing microtubule bundles 13 1. 2. 3 .1 Minus-end-directed motor protein—Klp2p 14 1. 2. 3 .2 Bundling ... Architecture and dynamics of interphase microtubule cytoskeleton 18 1. 2. 4 .1. 2 Functions of interphase microtubule cytoskeleton 19 1. 2. 4 .1. 2 .1 Maintaining cell morphology 19 1. 2. 4 .1. 2. 2 Controlling central ... 1. 2 .1. 1 Spindle pole body (SPB) 1. 2 .1. 2 Non-centrosomal MTOCs 1. 2 .1. 2 .1 Interphase microtubule organizing centers (iMTOCs) 1. 2 .1. 2. 2 Equatorial microtubule organizing centers (eMTOC) 1. 2 .1. 2. 3...

Ngày tải lên: 12/09/2015, 08:19

... important role in establishment and maintenance of cell polarity and overall intracellular organization 18 1. 2. 4 .1. 2 Functions of interphase microtubule cytoskeleton 1. 2. 4 .1. 2 .1 Maintaining cell morphology ... marker, Tea1p, plays a critical role in maintaining cell morphology by binding to the plus ends of growing interphase microtubules in a Tip1p and Tea2p -dependent manner (Chang and Peter, 20 03) When ... following cartoon (Chang and Peter, 20 03) 20 Role of microtubules in regulating cell polarity in fission yeast a, Tea1p binds to the growing plus end of MTs (green) in a Tip1p and Tea2p dependent...

Ngày tải lên: 12/09/2015, 08:19

... Cell 73, 611 – 620 12 Schlessinger, J (19 93) How receptor tyrosine kinases activate Ras Trends Biochem Sci 18 , 27 3 27 5 13 Pawson, T & Scott, J.D (19 97) Signalling through scaffold, anchoring, and adaptor ... 364, 24 9 25 2 Ó FEBS 20 04 25 Carroll, M.P & May, W.S (19 94) Protein kinase C-mediated serine phosphorylation directly activates Raf- in murine hematopoietic cells J Biol Chem 26 9, 12 49 12 56 26 Cai, ... mitogen-activated protein kinase signalling pathway in human tumors Oncogene 18 , 813 – 822 21 Bos, J.L (19 89) ras oncogenes in human cancer: a review Cancer Res 49, 46 82 4689 22 Kholodenko, B.N (20 00) Negative...

Ngày tải lên: 19/02/2014, 16:20

... Biol Chem 2 61, 10 765 10 7 71 23 Miles LA, Dahlberg CM & Plow EF (19 88) The cellbinding domains of plasminogen and their function in plasma J Biol Chem 26 3, 11 928 11 934 24 Thewes T, Constantine K, ... 26 5, 610 4– 611 1 19 Tulinsky A, Park CH, Mao B & Llinas M (19 88) Lysine ⁄ fibrin binding sites of kringles modeled after the structure of kringle of prothrombin Proteins 3, 85–96 20 Thorsen S (19 75) ... of plasminogen in vivo J Biol Chem 26 0, 12 106 12 111 57 Wiman B & Wallen P (19 73) Activation of human plasminogen by an insoluble derivative of urokinase Structural changes of plasminogen in the...

Ngày tải lên: 20/02/2014, 01:20

... Src pY 424 Src 10 20 D101N/Y535F 10 20 C R183K/Y535F 10 20 (min) C Src pY 424 Src Autophosphorylation (a.u.) 10 20 10 20 (min) 0 .20 0 .15 Y535F (5) D101N/Y535F (6) R183K/Y535F (6) D101N/R183K/Y535F ... [nM] 15 0 0 10 0 20 0 300 400 10 0 Time (s) D101N/Y535F 0.8 0.6 0.4 KD = 22 7.3 ± 31. 5 0 .2 0 20 10 0 20 0 300 400 [nM] 10 40 30 0.8 0.6 0.4 KD = 19 9.9 ± 31. 1 0 .2 20 10 0 20 0 300 400 [nM] 10 0 10 0 20 0 ... Semba K, Mishina M, Manabe T & Yamamoto T (20 01) Characterization of Fyn-mediated 6 52 16 17 18 19 20 21 22 23 24 25 26 27 tyrosine phosphorylation sites on GluRe2 (NR2B) subunit of the N-methyl-d-aspartate...

Ngày tải lên: 06/03/2014, 01:20