in which set and map lend a hand

CLEANER PRODUCTION AUDIT IN THE PULP AND PAPER INDUSTRY: A CASE STUDY IN VIETNAM doc

CLEANER PRODUCTION AUDIT IN THE PULP AND PAPER INDUSTRY: A CASE STUDY IN VIETNAM doc

... storage tank then pumped to a beater Waste paper and water are added into beater Here pulp and waste paper is beaten into fine fiber Then it is transported to a sedimentation tank where sand and ... cooking, washing, diluting, beating and paper machine were measured separately Cooking, washing and beating are batch processes Therefore it was decided that the water consumption amount was measured ... Total N , total P were analyzed in the laboratory All the analysis was conducted according to the techniques provided in the “Standard methods” of examination for the water and wastewater (APHA,...

Ngày tải lên: 09/03/2014, 01:20

98 762 0
Case Study in Financial Modeling and Simulation of a Forestry Investment potx

Case Study in Financial Modeling and Simulation of a Forestry Investment potx

... watering  Maintenance:- weed control, fertilizing, pruning and thinning, fire and pest protection  Inflows:wood; commercial thinning, final harvest non-wood; flora gathering, recreation, land ... Evaluation Criteria The Land Expectation Value(LEV) model is applied in preference to the NPV model Key Parameters in Forestry Models Establishment:- land, land preparation, plant stock, planting, ... usage and fashion changes  Sovereign risk: regulatory changes, taxation changes, uncertain harvest rights Predicting Cash Flows The key growth indicator is the Mean Annual Increment 20 Years...

Ngày tải lên: 23/03/2014, 04:20

18 786 4
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used ... peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, respectively,...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

... (FLAG-positive) TAC Y GGG G NNS X TAC Y AAG K CTG L NNS X AAG K GAT D GAT D GAT D GAT D GAC D GAC D GAC D GAC D GAT D GCG A NNS X GAT D GAT D GAT D GAT D CGA R AAG K AAG K AAG K TAA * same experimental protocol ... perturbing the folding of the underlying (ba)8-barrel This was investigated by comparing the far-UV and near-UV CD spectra of PRAI and FLAG-PRAI in a buffer in which PRAI retains catalytic activity ... for affinity measurements by surface plasmon resonance (SPR) On acquiring SPR data for FLAG-PRAI and trPRAI binding to mAb M2, it became apparent that the latter displayed increased binding at any...

Ngày tải lên: 30/03/2014, 20:20

14 382 0
NEEDS AND PROBLEMS IN ENGLISH LISTENING AND SPEAKING SKILLS: A CASE STUDY OF THE METROPOLITAN POLICE OFFICERS AT COUNTER SERVICE AT CHANA SONGKRAM POLICE STATION pot

NEEDS AND PROBLEMS IN ENGLISH LISTENING AND SPEAKING SKILLS: A CASE STUDY OF THE METROPOLITAN POLICE OFFICERS AT COUNTER SERVICE AT CHANA SONGKRAM POLICE STATION pot

... and wants, 3) giving information about accommodation, tourist information, transportation, and emergency calls, 4) giving directions, and 5) giving advice and instruction in safety, travel, and ... elements are further defined below 1) Language Data Learners need samples of listening and speaking language Learners can access to appropriate samples of oral language in contexts that make transparent ... (1991) indicated that 12 ESP is an enterprise involving training and practice and draws up three major realms of knowledge: language, pedagogy and the people’s participant specialist areas of interest...

Ngày tải lên: 02/04/2014, 05:20

100 1,3K 5
ROAR! Get heard in the sales and marketing jungle: A business fable

ROAR! Get heard in the sales and marketing jungle: A business fable

... President and CEO, Galaxy Desserts “Finally in ROAR! I found a book that is both inspiring and practical Mr Daum has a keen grasp of how to understand customers, and his work was an inspiration to ... a great airplane read.” —Gary Moon Managing Director, Ridgecrest Capital Partners A fun, easy to read, and brilliant business book I’ve passed along copies of ROAR! for our management team and ... Sitting at Penn Station, sweating from the summer heat and waiting for his train home, Ryan fantasized about trading it all in and joining the Peace Corps His reverie was interrupted when he heard...

Ngày tải lên: 07/04/2014, 11:11

225 372 0
Báo cáo hóa học: " Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach" potx

Báo cáo hóa học: " Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach" potx

... differences in parameters describing angular and temporal aspects of hand kinematics and inter-joint, inter-digit coordination Results: The angular profiles of hand opening and closing were accurately ... Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach Ilaria Carpinella1*, Johanna Jonsdottir2 and Maurizio Ferrarin1 Abstract Background: Approximately ... closing and normalized in time as a percentage of the movement duration (%Dur) Joint angle mathematical characterization and accuracy After data normalization, each joint angular profile was mathematically...

Ngày tải lên: 19/06/2014, 08:20

20 343 0
báo cáo hóa học:" Comparison of effectiveness of Halo-femoral traction after anterior spinal release in severe idiopathic and congenital scoliosis: a retrospective study" ppt

báo cáo hóa học:" Comparison of effectiveness of Halo-femoral traction after anterior spinal release in severe idiopathic and congenital scoliosis: a retrospective study" ppt

... formation, patients as defect of segmentation and 16 patients had combined anomaly The average age of the patients was 15.2 years (ranged 10– 20) The average coronal Cobb angle of the main curve was 95.7° ... surgery, and was maintained as 31.6° (ranged 21°–52°) at final follow-up For CS cases, initial mean thoracic kyphosis was 70.2° (ranged 28°–155°) and decreased to 39.0° (ranged 11°–82°) post-operatively ... Blanke K, Baldus C: Preoperative spinal canal investigation in adolescent idiopathic scoliosis curves ≥70° Spine 1994, 19:1606-1610 Tokunaga M, Minami S, Kitahara H, Isobe K, Nakata Y, Moriya...

Ngày tải lên: 20/06/2014, 01:20

7 351 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot

Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot

... The Netherlands) For chemical analysis, standard stock solutions of the analytes and the internal standards were prepared both in methanol and hexane and stored at 7°C The working standard solutions ... effects and methodological losses of analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of detection and ... of analytes [39,40] Quantitative analysis of the investigated pharmaceuticals and PAHs were therefore carried out using appropriate isotopically labeled surrogate standards to compensate for matrix...

Ngày tải lên: 20/06/2014, 20:20

13 589 0
báo cáo hóa học:" Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage " pdf

báo cáo hóa học:" Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage " pdf

... The Netherlands) For chemical analysis, standard stock solutions of the analytes and the internal standards were prepared both in methanol and hexane and stored at 7°C The working standard solutions ... effects and methodological losses of analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of detection and ... of analytes [39,40] Quantitative analysis of the investigated pharmaceuticals and PAHs were therefore carried out using appropriate isotopically labeled surrogate standards to compensate for matrix...

Ngày tải lên: 21/06/2014, 17:20

13 475 0
Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps

Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps

... pe(Matt) Liebl: a multivariate approach to the hybrid problem Data acquisition analysis and interpretation Watsonia 12, 81-101 Rushton BS (1983) An analysis of variation of traea leaf characters ... into two large (1 and 2) and one small group (3) (fig 1) .In table I, the mean values are indicated for each of the groups, and the F-values of the variance-analytical comparison of groups and (Welch-Test, ... see Aas, 1988) Oaks chosen from 30 different stands in and Poland (stands of pedunculate oak, sessile oak and mixed stands; the number of specimen trees per stand varied between and 20) The majority...

Ngày tải lên: 08/08/2014, 19:21

7 287 0
Báo cáo y học: "Global utilization of low-dose corticosteroids in severe sepsis and septic shock: a report from the PROGRESS registry" potx

Báo cáo y học: "Global utilization of low-dose corticosteroids in severe sepsis and septic shock: a report from the PROGRESS registry" potx

... Peru, Colombia, Venezuela and Puerto Rico Northern America: United States and Canada Oceania: Australia and New Zealand Asia: India, Malaysia, Philippines, Singapore, Israel, Taiwan, Thailand, Hong ... overall, and for patients with and without vasopressors Continuous variables were compared across treatment groups using non-parametric analysis of variance (ANOVAs) and qualitative variables ... Summary of Baseline Characteristics Used in Mortality Models and Associated Hospital Mortality, a Univariate Analysis; Table S5: Improvement in Baseline Imbalance Using Propensity Score Analysis...

Ngày tải lên: 13/08/2014, 20:22

14 377 0
Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot

Báo cáo y học: " Updating the evidence for the role of corticosteroids in severe sepsis and septic shock: a Bayesian meta-analytic perspective" pot

... Briegel and colleagues [39] Chawla and colleagues [47] Yildiz and colleagues [45] Annane and colleagues [36] Tandan and colleagues [44] Oppert and colleagues [42] Sprung and colleagues [8] NA, not available ... colleagues Annane and Table Trial patient data by outcome (Continued) #, mortality statistics for Chawla and colleagues [47] were abstracted from the Annane and colleagues meta-analysis[6] ##, data ... on inflammation [57], vascular reactivity [58] and interactions between corticosteroids and ‘signalling pathways’ [59] may explain the salutary effects in sepsis [60]; anti-inflammatory and coagulation...

Ngày tải lên: 13/08/2014, 21:21

15 536 0
Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx

Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx

... Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, et al.: Initial sequencing and comparative analysis of the mouse genome Nature 2002, 420:520-562 Thomas JW, Touchman JW, ... subsequent querying Additional data files The following additional data are available with the online version of this paper Additional data file provides the human ALL gene set Additional data file provides ... mouse ALL gene set Additional data file provides the human FAM2 gene set Additional data file provides the mouse FAM2 gene set Additional data file provides the human NEW gene set Additional data...

Ngày tải lên: 14/08/2014, 08:20

11 357 0
conjunctions in some english and vietnamese newletters a contrastive analysis = phân tích đối chiếu liên từ trong một số bức thư ngỏ tiếng anh và tiếng việt

conjunctions in some english and vietnamese newletters a contrastive analysis = phân tích đối chiếu liên từ trong một số bức thư ngỏ tiếng anh và tiếng việt

... conjunctions in two languages are used as transition signals of ideas and sentences to create the logic and coherence in a paragraph (iii) coordinators and subordinators exist in both English and Vietnamese ... word-class conjunction is a traditional one which can be divided into coordinating and subordinating conjunctions Coordinating conjunctions join grammatically equal elements whereas subordinating ... implications for language teaching, learning and translation are given at the end of this part with a view to providing a new insight into a very important device of linking in English and Vietnamese...

Ngày tải lên: 02/03/2015, 14:30

55 1,2K 7
Teacher and students’ factors affecting students’ participation in pair work and group work – A case study at Luong Van Tuy Gifted High School

Teacher and students’ factors affecting students’ participation in pair work and group work – A case study at Luong Van Tuy Gifted High School

... to language teaching, pair work and group work arrangement in language teaching and learning and human factors affecting the students’ participation in pair work and in group work I COMMUNICATIVE ... few years, the application of the communicative language teaching method has been widely adopted This marked the beginning of a major change in the language teaching and learning at Luong Van Tuy ... teaching, speaking skills and its related concepts, classroom work arrangement (pair work and group work) and the concept of students’ participation in pairs and in groups and factors affecting students’...

Ngày tải lên: 04/08/2015, 09:40

16 610 7
Conjunctions in some English and Vietnamese newletters a contrastive analysis

Conjunctions in some English and Vietnamese newletters a contrastive analysis

... implications for language teaching, learning and translation are given at the end of this part with a view to providing a new insight into a very important device of linking in English and Vietnamese ... Vietnamese Marketing Newsletters” The author analyzes and contrasts how to use conjunctions in English and Vietnamese marketing newsletters based on the syntactic and semantic features to find ... Newsletters, Published in the United States of America 12 Hamilton, E A (1996), Newsletters Design, Published in the United States of America 13 Hussain, N (2008), Advantages and disadvantages of Newsletters,...

Ngày tải lên: 10/08/2015, 19:51

4 483 5
Conjunctions in some English and Vietnamese Newsletters A contrastive analysis

Conjunctions in some English and Vietnamese Newsletters A contrastive analysis

... conjunctions in two languages are used as transition signals of ideas and sentences to create the logic and coherence in a paragraph (iii) coordinators and subordinators exist in both English and Vietnamese ... conjunctions are divided into three main types: coordinators, subordinators, and correlatives while Vietnamese conjunctions only have two main types including coordinating and subordinating conjunctions ... customers And conjunctions are seen as an essential means of linking so as to increase the persuasion in newsletters Therefore, studying and finding the similarities and differences in using conjunctions...

Ngày tải lên: 10/08/2015, 19:51

16 1,4K 24
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 17)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 17)

... principle, the sampling, extraction and GC analysis should be made at low temperature, in a gastight state and in a short time This method is applicable to other biomedical specimens and drinks/foods ... transformation in rats J Pharm Sci 74:780–782 10) Kielbasa WB, Bauer JA, Fung HL (1999) Analysis of isobutyl nitrite inhalant in rat and human blood: application for pharmacokinetic investigations J Chromatogr ... concentration of an alkyl nitrite on the horizontal axis and peak area on the vertical axis The concentration of the analyte in a specimen is calculated using the calibration curve i Assessment and some...

Ngày tải lên: 18/10/2013, 00:15

6 580 0
w