in the model of multi independent samples a observations numbers in groups sample sizes may be different
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
Ngày tải lên :
12/08/2014, 17:22
... Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene ... chains of aggrecan Red Safranin O staining was present in the AF and the vertebral growth plates in the control group (Figure 5a) The NP was rounded, and distinct from the AF The Safranin O-stained ... performed the biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the...
- 9
- 402
- 0
Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot
Ngày tải lên :
13/08/2014, 21:20
... not increase FRC in grade IV IAH PEEP did not increase PaO2 values in IAH The minimal PaO2 decrease as compared to the relatively larger FRC decrease in the setting of raised IAP can be explained ... bacterial translocation J Trauma 2002, 52:13-17 Kitano Y, Takata M, Sasaki N, Zhang Q, Yamamoto S, Miyasaka K: Influence of increased abdominal pressure on steady-state cardiac performance J Appl ... propofol (1 mg/kg) was administered The trachea was intubated via the oral route with a cuffed endotracheal tube (size 8.0 mm, Hi-Lo, Mallinckrodt, Athlone, Ireland) Anaesthesia was maintained...
- 11
- 406
- 0
Mechanisms of neurodegeneration and stem cell migration a study of molecular signals in the model of axotomy
Ngày tải lên :
16/09/2015, 17:12
... content in the neuron Still later, after axonal outgrowth has been initiated, there may be an increase in the overall amount of proteins that are axonally transported or in their rate of transport ... through an axon Most materials like tubulin, actin and neurofilamentous proteins are transported anterogradely from the perikaryon to the axon terminal at a fast and a slow rate In mammals, fast transport ... component, the gp130 molecule, triggers a cascade of intracellular events including activation of JAKs-STAT pathway or Raf-MEK-MAPK pathway, leading to the activation of transcriptional factors (Darnell,...
- 288
- 337
- 0
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability
Ngày tải lên :
18/12/2013, 10:08
... use of brainstorming Table 8: The reasons of approval of the application of brainstorming in the future Table 9: The reasons for disapproval of application of brainstorming in the future Chart ... brainstorming at prewriting stage in the future Students were eager to take part in brainstorming since they had found the advantage of brainstorming It can be said that majority of students had ... Teaching writing has been an essential element in all educational systems and there are several view of the best ways of going about two main approaches They are product approach and process approach...
- 60
- 717
- 0
Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc
Ngày tải lên :
17/02/2014, 22:20
... Congress Cataloging -in- Publication Data Arena, Mark V Why has the cost of Navy ships risen? : a macroscopic examination of the trends in U.S Naval ship costs over the past several decades / Mark V Arena, ... quantities, ultimately leading to a shrinking fleet size To counter the increasing cost, the Navy can target some of the main factors related to escalation, such as those related to the capability and complexity ... the DD[X] and driving a teaming arrangement for the production of the Virginiaclass submarine) Conclusions The cost escalation for naval ships is nearly double the rate of consumer in ation The...
- 124
- 583
- 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx
Ngày tải lên :
05/03/2014, 21:20
... committees of the School of Medical Sciences of the State University of Campinas, Campinas, São Paulo RESULTS The data analyzed came from a total of 958 individuals—929 males and 029 females 60 years of ... questionnaire that was administered directly to the sampled individuals by trained interviewers The questionnaire was organized into 19 subject areas including the scales of the SF-36® The variables analyzed ... Health for financial support in the data analysis through the Health Analysis Collaborative Center of FCM/UNICAMP (partnership 2763/2003); and to the Secretary of Education of the State of Minas...
- 8
- 701
- 0
The Privatization of Italian Savings Banks – A Role Model for Germany?* doc
Ngày tải lên :
22/03/2014, 21:20
... legally separating the banking business from social or cultural activities These foundations maintained the public mandate of the savings banks, such as the advancement of the local economy These ... against the privatization of savings banks is that it may lead to a deterioration in the availability of banking services In fact, the regional provision of banking services can be seen as one of ... Privatization of Italian Savings Banks – A Role Model for Germany? banking reforms appear to have led to a rapid increase in the number of branch offices rather than to a decrease, as would have...
- 19
- 469
- 0
Monetary Policy in the Eurozone: Evaluating the European Central Bank’s interest rate decisions and the needs of member states using a Taylor rule ppt
Ngày tải lên :
29/03/2014, 13:20
... through the OECD’s statistics database Inflation numbers were available on a quarterly basis Quarterly GDP data were obtained from the same OECD source and had already been seasonally adjusted by the ... “timings” of the data is addressed again by the nature of this study as observational rather than normative In addition, Peersman and Smets find that the “estimation error in the output gap does ... through the use of ex post data as the data available at the time of this investigation, March 2012, are late enough to represent the revised versions of many of the numbers used The issue of the...
- 41
- 513
- 0
Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt
Ngày tải lên :
30/03/2014, 20:20
... difficult to assess in vivo, is involved in these pathways Since adenine is a substrate of ADPRT, the elevation of ATP in the absence of adenosine kinase shows that adenine must be released in the process ... mentioned in the Introduction that patients deficient in ADPRT are accumulating adenine [8–11] The modes of adenosine salvage (Table 3) all require AK, so that they are not operative in the case of AK ... predict that there is redundancy both in adenine salvage and in adenosine salvage in that parallel pathways producing ATP from each of these substrates exist While the metabolism of many cells...
- 13
- 476
- 0
Báo cáo hóa học: " Characterizing the burden of premature ejaculation from a patient and partner perspective: a multi-country qualitative analysis" docx
Ngày tải lên :
18/06/2014, 22:20
... for the analysis [23,24] This approach means that themes that are identified need to be grounded or rooted based on examination of the data and not initially imposed on the data The research team, ... related to the ability of bringing their partners to climax during vaginal intercourse The women reported that the meaning of this item was based on their ability to achieve orgasm through vaginal ... there's a large part of you that is missing or failed." In addition to inadequacy, many of the men reported feeling anxious, frustrated, angry, and disap- Page of 10 (page number not for citation...
- 10
- 514
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
Ngày tải lên :
19/06/2014, 10:20
... variability and unsteadiness, have an excessive fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, ... typically adapt a slower gait [11-13] Variability of foot placement, at least during gait termination, may also be increased when lighting is not adequate [12] These changes are reminiscent of the ... repeated measures For each gait parameter, a separate model was applied The dependent variable was the gait parameter and the independent variables were the group (patients or controls), the walking...
- 8
- 415
- 0
Báo cáo y học: "Role of Leukotriene Receptor Antagonists in the Treatment of Exercise-Induced Bronchoconstriction: A Review" pot
Ngày tải lên :
08/08/2014, 20:23
... 1999;33:1299–314 National Heart, Lung, and Blood Institute, National Asthma Education Program Guidelines for the diagnosis and management of asthma Expert Panel report II Bethesda (MD):US Department of Health ... during the first days of treatment with either montelukast or salmeterol, but again, the protection was lost in the salmeterol group after weeks of treatment Protection was maintained in the ... life 64 Allergy, Asthma, and Clinical Immunology / Volume 1, Number 2, Spring 2005 References Blake KV Montelukast: data from clinical trials in the management of asthma Ann Pharmacother 1999;33:1299–314...
- 5
- 663
- 0
Báo cáo y học: "The opposite effects of fluvoxamine and sertraline in the treatment of psychotic major depression: a case report" potx
Ngày tải lên :
08/08/2014, 23:21
... fluvoxamine (150 mg) monotherapy was maintained, and her condition remained good At years after the disappearance of the delusions, the patient began overeating and oversleeping, as well as experiencing ... that activation of the dopaminergic system by the inhibition of dopamine transporter may be involved in the mechanism of unwanted effects (deterioration of psychosis) of sertarline in this case, ... Ishikawa M, Ishiwata K, Ishii K, Kimura Y, Sakata M, Naganawa M, Oda K, Miyatake R, Fujisaki M, Shimizu E, Shirayama Y, Iyo M, Hashimoto K: High occupancy of sigma-1 receptors in the human brain after...
- 3
- 401
- 0
Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps
Ngày tải lên :
09/08/2014, 06:22
... corresponding to amino acids 317–616 mapping at the carboxy terminus of RANK of human origin [H-300]) or against RANKL (rabbit polyclonal antibody raised against the epitope corresponding to amino acids ... staining for RANKL in synovial cells and in the infiltrating (inflammatory) cells (Fig 4h) There was a marked increase in RANKL expression, consistent with the increase in inflammatory cells and ... RANK/ RANKL in inflammatory cells, in inflamed synovium, in articular cartilage and at the invading front of bone erosions It has been long recognized that pro-inflammatory cytokines are intimately...
- 8
- 380
- 0
Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps
Ngày tải lên :
09/08/2014, 10:20
... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal ... years ago as part of multimodality treatment of an acute lymphoblastic leukaemia About four years later he presented with an anaplastic astrocytoma and therefore received external beam radiation ... Treat 2006, 5:591-596 Penagaricano JA, Papanikolaou N, Yan Y, Ratanatharathorn V: Application of intensity-modulated radiation therapy for pediatric malignancies Med Dosim 2004, 29:247-253 Paulino...
- 10
- 523
- 0
Báo cáo y học: "Are chest compressions safe for the patient reconstructed with sternal plates? Evaluating the safety of cardiopulmonary resuscitation using a human cadaveric model" docx
Ngày tải lên :
10/08/2014, 09:22
... Control lateral, xyphoid Cadaver 1 inferolateral Cadaver 2 lateral, xyphoid Cadaver lateral Cadaver lateral Cadaver lateral Figure Elevation and examination of deep sternal cortex and viscera McKay ... removed from the plates and each plate was disassembled Each screw, pin and plate was examined for damage or failure Results The plating mechanism was visually evaluated for damage and checked ... incidence in resuscitated adults ranging from 12.9% to 96.6% [8] The most common complication of rib fractures is pain; pain may inhibit deep breathing, which may increase the risk of atelectasis...
- 4
- 316
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
Ngày tải lên :
10/08/2014, 10:23
... relationship between intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in ... TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an ... most often when exploring the determinants of professional behaviour [9] The theory states that an individual’s intention to perform a behaviour is the proximal predictor of behaviour In turn, intention...
- 9
- 367
- 0
báo cáo khoa học: "Understanding the context of Balanced Scorecard Implementation: a hospital-based case study in Pakistan" ppt
Ngày tải lên :
10/08/2014, 10:23
... Its inpatients have an average length of stay of 3.9 days The hospital has an International Organization for Standardization (ISO) certification and a Joint Commission International (JCI) accreditation ... study the implementation of the modern performance management tool, the BSC, in a private academic tertiary hospital in Karachi, Pakistan The main operational study question was: ‘What are the ... co-authorship, promotion etc, leadership communicating a clear agenda Financial incentives in lieu of clinical time released Financial incentives in lieu of clinical time released Lack of interest...
- 14
- 421
- 0
báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps
Ngày tải lên :
10/08/2014, 11:20
... team’s main tasks are described in a protocol and include formulating a QI action plan, monitoring of performance using the feedback reports, and initiating and evaluating QI activities (see Table ... Use and misuse of process and outcome data in managing performance of acute medical care: avoiding institutional stigma The Lancet 2004, 363:1147-1154 Donabedian A: Evaluating the quality of medical ... performance data and therefore less threatening to participating units It also increases the feasibility of the study, because clinical human resources are scarce in intensive care the range of 2.2...
- 10
- 421
- 0
Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot
Ngày tải lên :
10/08/2014, 21:24
... biological therapies However, despite these advances evidence indicates that active disease in the foot is an ongoing problem in clinical practice A new paradigm of podiatry care can adopt these advancements ... foot care in early RA If proven, the paradigm may be generalisable to other forms of inflammatory, post-traumatic and degenerative disorders in the musculoskeletal field as well as a model for the ... Arthritis Clinics as part of the multidisciplinary team Accordingly patients should be targeted and treated aggressively using injection therapy and personalised Woodburn et al Journal of Foot and Ankle...
- 10
- 383
- 0