... instance, we need to take the loaded XML data, place it into indexed positions of an array, and set that array as the data provider for the playlist_lb instance As a result, our loaded XML data appears ... tempArray, each with label and data properties representative of song names and song filenames, as just described The last action within the onLoad event handler sets tempArray as the data provider ... the data after loading it Let's look at this event handler in detail It's important to remember that the data loaded in from this XML file contains the name of each song, such as Agent 00, and...
Ngày tải lên: 07/11/2013, 15:15
... for databases as well When you import the database that you want to use, FrontPage places a copy of the database in your Web 11 12 Module 1: Displaying Data from a Database ! Import a database ... connecting to a database by using the Database Results Wizard Lead-in The Database Results Wizard helps to establish a connection between a Web page and a database After importing a database to the ... FrontPage 2000 makes it easy to collect and display data on Web pages and create a Web database application In order to use the information in a database on your pages, you need to create a database...
Ngày tải lên: 11/12/2013, 14:15
Tài liệu Module 1: Displaying Data from a Database ppt
... for databases as well When you import the database that you want to use, FrontPage places a copy of the database in your Web 11 12 Module 1: Displaying Data from a Database ! Import a database ... connecting to a database by using the Database Results Wizard Lead-in The Database Results Wizard helps to establish a connection between a Web page and a database After importing a database to the ... FrontPage 2000 makes it easy to collect and display data on Web pages and create a Web database application In order to use the information in a database on your pages, you need to create a database...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Connecting to a Text File pptx
... OleDbDataAdapter da = new OleDbDataAdapter("SELECT * FROM [Categories.txt]", ConfigurationSettings.AppSettings["TextFile_0119_ConnectString"]); // Create and fill the table DataTable dt = new DataTable("Categories"); ... records into a text file data source The Jet database engine can access other database file formats through Indexed Sequential Access Method (ISAM) drivers specified in the Extended Properties attribute ... Filename File format Field names, widths, and data types Character set Special data type conversions The first entry in the schema.ini file is the text filename enclosed in square brackets For...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Updating a Data Source with Data from a Different Data Source doc
... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... contains data and schema information within its contained objects, but not information about the provider that was used to retrieve the data or the original source of the data The DataSet tracks...
Ngày tải lên: 21/01/2014, 11:20
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc
... sputa was performed All clinical and laboratory testing was part of routine examination For HIV testing, specific informed consent was asked and counseling offered Approval for this study was ... cavities and unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a ... in 34 and apical infiltrations in 73 patients There were no missing data on any of the tests or signs for the 300 patients Classical contingency table analysis showed a significant correlation...
Ngày tải lên: 22/03/2014, 18:20
Báo cáo khoa học: "Automatic Acquisition of Script Knowledge from a Text Collection" docx
... International Workshop on Sharable Natural Language Resources, Nara, Japan, pages 48-55 Daniel Marcu 2000 The Theory and Practice of Discource Parsing and Summarization The MIT Press National Language ... Promotion Agency, Japan) 2002 Generic Engine for Transposable Association: GETA http://geta.ex.nii.ac.jp/ Sadao Kurohashi and Makoto Nagao 1994 KN Parser: Japanese Dependency/Case Structure Analyzer ... facts The texts are arranged in time order The texts are on a similar topic To construct a text collection that satisfies the above conditions, we used a corpus of newspaper articles and performed...
Ngày tải lên: 31/03/2014, 20:20
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf
... Milliken et al (2007) age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and those ... whether or not reservists discharged their weapon in combat (data available from authors) Fair or poor assessment of health based on the SF-36 were comparable for UK and US regulars, but significantly ... who are National Guard or reserves; data are shown are for US or UK personnel overall e Data on combat experiences colleted at phase for the UK study (i.e combat experiences data collected before...
Ngày tải lên: 11/08/2014, 17:20
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
... S AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx
... raw data sets and takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda ... Cardiology Circulation 2006, 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics and degree ... 158) had an Agatston score of greater than 10, and 1.4% (n = 34) had an Agatston score of greater than 100 As expected in a cohort free of clinical CAD, relatively few participants had an Agatston...
Ngày tải lên: 12/08/2014, 15:23
Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx
... replaced according to the SF-36 manual [47] When an item was missing on the HADS and IES, missing data were replaced with the patients’ mean value for each subscale Data on categorical variables ... the data, performing the data analyses and writing the article LS also collected data ISB, LS and HM participated in the planning of the study and discussions during data analyses, read the manuscript ... LPH: Prevalence and determinants of disabilities and return to work after major trauma J Trauma 2005, 58:126-135 Vazquez MG, Rivera FR, Perez AA, Gonzalez CA, Fernandez ME, Navarrete NP: Analysis...
Ngày tải lên: 13/08/2014, 23:20
Tài liệu Create a New Table with Data from Existing Tables doc
... build the data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) Catch ... DataSource property is set to the data table that was filled Listing 6.17 frmHowTo6_7.vb: Loading the Form Private Sub btnExecute_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) ... odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data grid's DataSource property Me.dgResults.DataSource = dtResults End Sub...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
... Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load 'Put user code to initialize the page here Dim odaProdIndiv As OleDb.OleDbDataAdapter odaProdIndiv ... dsProducts DataGrid dgProducts DataSource dsProducts DataKeyField ProductID DataMember Products ID hplReturnToMain NavigateURL HyperLink ID wfrmMain.aspx Right-click on the DataGrid control and choose ... first form The dtProdIndiv data table is filled, and the individual column information is loaded into the text boxes Listing 5.31 wfrmHowTo5_8b.aspx.vb: Loading the Detail Information Based on...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu Báo cáo khoa học: "Extracting Comparative Sentences from Korean Text Documents Using Comparative Lexical Patterns and Machine Learning Techniques" doc
... phrase, V: verb phrase) Thus we defined comparative keyword in this paper as follows: Definition (comparative keyword): A comparative keyword is formed as a word or a phrase or a long-distance-words ... Gil-jong Ha 1999 Research on Korean Equality Comparative Syntax, Association for Korean Linguistics, 5:229-265 In-su Jeong 2000 Research on Korean Adjective Superlative Comparative Syntax Korean Han-minjok ... for Computational Linguistics, 193-200 Andrew McCallum and Kamal Nigam 1998 A Comparison of Event Models for Naïve Bayes Text Classification Association for Advancement of Artificial Intelligence,...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... collocation's keys occur on the same sentence, as they are in a syntactical relation) When parallel corpora are available, also the translation equivalents of the collocation context are displayed, ... neighbourhood for the optimal candidate as target paragraph We perform two kinds of tests on the paragraphs in this span: a test of paragraph content, and a test of paragraphs relative size matching ... cases, justifying our approach Collocation Dictionary We used the collocations extracted from the French and English corpora for creating a database of knowledge that integrates collocations and...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: "A DOM Tree Alignment Model for Mining Parallel Data from the Web" doc
... http://www.w3.org/DOM/ Related Work The parallel data available on the web have been an important knowledge source for machine translation For example, Hong Kong Laws, an English-Chinese Parallel corpus ... The Mathematics of Statistical Machine Translation: Parameter Estimation Computational Linguistics, V19(2) Callison-Burch, C and C Bannard 2005 Paraphrasing with Bilingual Parallel Corpora In ... Association for Machine Translation in the Americas Gale W A and K Church 1991 A Program for Aligning Sentences in Parallel Corpora In Proceedings of 29th Annual Meeting of the Association for...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "From route descriptions to sketches: a model for a text-to-image translator" doc
... report 540, M.I.T Artificial Intelligence Laboratory, Cambridge, MA A Yamada, T Yamamoto, H Ikeda, T Nishida, and S Doshita 1992 Reconstructing spatial image from natural language texts In Proc of ... have decomposed it into a path and landmarks A path is made up of transfers and relays Relays are abstract points initiating transfers and may be "covered" by a turn Landmarks can be either associated ... associated with relays or with transfers More formally, a route is structured into a list of segments, each segment consisting of a relay and of a transfer Landmarks are represented as possible attributes...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt
... collocation's keys occur on the same sentence, as they are in a syntactical relation) When parallel corpora are available, also the translation equivalents of the collocation context are displayed, ... neighbourhood for the optimal candidate as target paragraph We perform two kinds of tests on the paragraphs in this span: a test of paragraph content, and a test of paragraphs relative size matching ... cases, justifying our approach Collocation Dictionary We used the collocations extracted from the French and English corpora for creating a database of knowledge that integrates collocations and...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: "Learning Document-Level Semantic Properties from Free-text Annotations" pot
... Distributional Analysis Our analysis of the document text is based on probabilistic topic models such as LDA (Blei et al., 2003) In the LDA framework, each word is generated from a language model that ... Carlin, Hal S Stern, and Donald B Rubin 2004 Bayesian Data Analysis Texts in Statistical Science Chapman & Hall/CRC, 2nd edition Sharon Goldwater, Thomas L Griffiths, and Mark Johnson 2006 Contextual ... hidden Across a variety of evaluation scenarios, our algorithm consistently outperforms alternative strategies by a wide margin Related Work Review Analysis Our approach relates to previous work...
Ngày tải lên: 23/03/2014, 17:20
Báo cáo khoa học: "A Multi-resolution Framework for Information Extraction from Free Text" pptx
... of anchor pair A i and A j 5.3 Evaluation of templates At this stage, we have a set of accepted integral relation paths between any anchor pair A i and A j The next task is to merge appropriate ... The reported accuracy of Spade is 49% on the RST-DT corpus To obtain a clausal path, we map each anchor A i to its clause in Spade If anchors A i and A j belong to the same clause, we assign ... matches slot C in a template Third, we find the correct patterns for the following cases: 1) A i , A j are of correct anchor types; and 2) A i is an action anchor, while A j is a correct anchor...
Ngày tải lên: 23/03/2014, 18:20