implications for a gene therapy cure for red green colorblindness
Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc
Ngày tải lên :
18/06/2014, 19:20
... Sugiyama A, Kume H, Ota S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor as a potential therapeutic target in clear cell renal cell carcinoma ... vectors, have already been extensively used to carry DNA for gene therapy For example, the intraperitoneal injection of DNA:PEI complexes is a Table The particle size and zeta potential of FA-PEAs Concentration(mg/ml) ... dissolve the MTT-formazan crystals The absorbance was measured at 490 nm by an ELISA microplate reader (Bio-Rad) Besides that, the toxicity on Ana-1 and HUVEC cells were evaluated with the same method...
- 10
- 453
- 0
báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot
Ngày tải lên :
20/06/2014, 03:20
... Sugiyama A, Kume H, Ota S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor as a potential therapeutic target in clear cell renal cell carcinoma ... vectors, have already been extensively used to carry DNA for gene therapy For example, the intraperitoneal injection of DNA:PEI complexes is a Table The particle size and zeta potential of FA-PEAs Concentration(mg/ml) ... dissolve the MTT-formazan crystals The absorbance was measured at 490 nm by an ELISA microplate reader (Bio-Rad) Besides that, the toxicity on Ana-1 and HUVEC cells were evaluated with the same method...
- 10
- 306
- 0
Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot
Ngày tải lên :
13/08/2014, 13:20
... (1386-5': GAAACTATGCCAAAAACAAGT and 2129-5': TAATCTAGCCTTCTGTCCTGG) and two internal gag-specific primers (1731N 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C 5': CACTAGCTTGCAATCTGGGTT), as previously ... DNA was extracted from macaque PBMCs and the amount used for each sample was normalized based on data for amplification of the β-globin gene, using 5'ACCATGGTGCTGTCTCCTGC-3' as sense primer, and ... salary from an organization that may in any way gain or lose financially from the publication of this paper in the past five years The authors never any stocks or shares in an organization that...
- 11
- 256
- 0
Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf
Ngày tải lên :
30/03/2014, 04:20
... terminal Ara6 motifs: Arafb1 fi 2Arafa1 fi 5(Arafb1 fi 2Arafa1 fi 3)Arafa1 fi 5Arafa1 About two-thirds of the terminal b-Araf and the penultimate 2 -a- Araf serve as attachment sites for mycolic acids ... The branched arabinan chains of the arabinogalactan are attached to the linear galactan backbone The arabinan consists of an inner linear region of Araf-(1 fi 5) -a- Araf and of branched non-reducing ... motifs: the Ara6 motif similar to that present in arabinogalactan, and a simplified linear Ara4 motif: Arafb fi 2Arafa1 fi 5Arafa1 fi 5Arafa1 Some of the non-reducing arabinofuranose termini are capped...
- 21
- 572
- 0
Báo cáo khoa học: " Implications of a high-definition multileaf collimator (HD-MLC) on treatment planning techniques for stereotactic body radiation therapy (SBRT): a planning study" pdf
Ngày tải lên :
09/08/2014, 10:20
... DesRosiers C, Randall M: Extracranial stereotactic radioablation: Physical principles Acta Oncol 2003, 42:882-894 Nagata Y, Takayama K, Matsuo Y, Norihisa Y, Mizowaki T, Sakamoto T, Sakamoto M, Mitsumori ... Cleveland, OH, USA) The imaging data was electronically transferred to the Eclipse radiation therapy planning system (Varian Medical Systems, Palo Alto, CA, USA) Based on both free-breathing and ... Haedinger U: Stereotactic radiotherapy of primary liver cancer and hepatic metastases Acta Oncol 2006, 45:838-847 Schefter TE, Kavanagh BD, Timmerman RD, Cardenes HR, Baron A, Gaspar LE: A phase...
- 7
- 239
- 0
Báo cáo y học: " A model of gene-gene and gene-environment interactions and its implications for targeting environmental " doc
Ngày tải lên :
13/08/2014, 16:21
... relatives share risk categories (which may be either environmental or genotypic, or both), rather than a particular genetic variant The probability that a relative of a proband is also a case ... that genetic variants are important in determining risk only for the relatively rare familial forms of cancer If so, genetic models of familial aggregation (for example [40]) may be incorrect and ... These alternative models imply that shared environmental factors may partially explain familial aggregation of breast cancer This contrasts with the classical twin method result (see earlier),...
- 24
- 603
- 0
Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx
Ngày tải lên :
14/08/2014, 19:22
... experiments and enzymatic assays SJ and AS carried out the immunohistochemical studies NGR and AS designed the experiments and evaluated the data All authors have read and approved the manuscript Acknowledgements ... M, Puranen M, Hurskainen H, Tyynela K, Turunen M, Vanninen R, Lehtolainen P, Paljarvi L, Johansson R, Vapalahti M, Yla-Herttuala S: Thymidine kinase gene therapy for human malignant glioma, using ... constant Statistics Statistical analysis was performed using the ANOVA and Student's t test (SPSS and Microcal Origin Software) A p value of
- 13
- 388
- 0
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
Ngày tải lên :
14/08/2014, 19:22
... Regulatory authorities also have a role to play Clinical trials are based on extensive preclinical experimentation and animal trials that take many years to complete Clearly, the particular vector ... means that the major safety issue faced by those wishing to use retroviral vectors is that of insertional mutagenesis and oncogene activation Insertional mutagenesis and oncogene activation As ... one instance where a vector contaminated with a replication competent virus was administered to animals viral replication per se did not appear to have an overt pathogenetic affect, rather a T-cell...
- 13
- 498
- 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
Ngày tải lên :
14/08/2014, 19:22
... denaturation at 94°C for 10 s annealing at 53°C for 30 s and extension at 72°C for 40 s, followed by a final extension at 72°C for 10 The relative amount of EGFR cDNA in each sample was calculated by ... Baselga J: The EGFR as a target for anticancer therapy – focus on cetuximab Eur J Cancer 2001, 37:S16-22 Tamm I, Dorken B, Hartmann G: Antisense therapy in oncology, new hope for an old idea? ... 5'GGAGCUGCCCAUGAGAAAUdTdT-3' and antisense 5'AUUUCUCAUG GGCAGCUCCdTdT-3' The unrelated nonspecific dsRNAs as control were designed as following: sense 5'-GAACUUCAGGGUCAGCUUG CCdTdT-3' and antisense 5'-GGCAAGCUGACCCUGAAGUUCdTdT3'...
- 12
- 314
- 0
Báo cáo sinh học: "Is gene therapy a good therapeutic approach for HIV-positive patients?" pot
Ngày tải lên :
14/08/2014, 19:22
... the target RNA forming a double-stranded RNA structure that either blocks translation or becomes a target for degradation in the cell Attractive targets for this type of therapy are gag and other ... not for citation purposes) Genetic Vaccines and Therapy 2007, 5:5 hairpin to form an intracellular siRNA To date, small interfering RNAs have been used in vitro to target viral genes like tat and ... by an intracellular anti-Rev single-chain antibody Proc Natl Acad Sci USA 1994, 91(11):5075-5079 Marasco WA, Haseltine WA, Chen SY: Design, intracellular expression, and activity of a human anti-human...
- 9
- 436
- 0
Identification and characterization of IFI30 as a glioblastoma specific promoter for glioma gene therapy
Ngày tải lên :
22/10/2015, 21:20
... exogenous genes, called transgenes, into somatic cells of a patient to obtain a therapeutic effect Initially gene therapy was considered as an approach for treating hereditary diseases, but it's ... IFI30-HSVTk was then used for the generation of recombinant bacmid IFI30 F ClaBamHI: 5'- ACGTATCGATACTTGGATCCTGGGTACCCTAGAGAAATGA-3’ IFI30 R NotI: 5'- ACTTGCGGCCGCTGCCTGGGAAATAAG-3' 28 Step Conditions ... make it an ideal target for selective gene therapy As gene therapy for GBM is localised there is minimum risk of systemic toxicity (Pulkkanen and Yla-Herttuala, 2005) Gene therapy is the transfer...
- 92
- 404
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
Ngày tải lên :
12/02/2014, 10:20
... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac ... primers for MCoTI-II gene cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg...
- 9
- 497
- 0
Tài liệu Báo cáo " English - A global language and its implications for students " ppt
Ngày tải lên :
12/02/2014, 20:20
... language” and two ways to make a language “global”, they are official status and education priority I also have given examples and cite ideas of [1] explanation to the way a language achieve the status ... cannot make a language “global”, many languages are easy to study in terms of grammar and vocabulary but they are not “global” Here, I agree with Crystal in respect of his point that a language cannot ... economical power are essential In other words, to maintain the status, a language needs a strong base and force to popularize itself Hardly anyone wants to learn a language of week and poor nation...
- 7
- 771
- 5
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
Ngày tải lên :
18/02/2014, 04:20
... ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin ... actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining ... are as follows: IL-1b: 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢...
- 11
- 653
- 0
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf
Ngày tải lên :
19/02/2014, 05:20
... experimentally, as we used P1,P5-di(adenosine-5¢)-pentaphosphate (Ap 5A) as inhibitor of adenylate kinase to prevent depletion of available ATP and ADP and to maintain steady-state respiration Instead, ... the ATPtotal ⁄ ADPtotal ratio reflect changes in the ATPout ⁄ ADPout ratio Palmitoyl-CoA caused a significant concentration-dependent decrease in the ATPtotal ⁄ ADPtotal ratio and increase in [AMP]total, ... (Supplementary material, Table S2) and steady-state fluxes (Table and [16] for glutamate plus malate and succinate, respectively) Values are mean ± SEM from three (succinate) or four (glutamate plus malate)...
- 15
- 546
- 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
Ngày tải lên :
19/02/2014, 18:20
... SPase similar to the various sip genes However, no type I SPase typical for Gram-positive bacteria or for Gram-negative bacteria (such as LepB) has been identified in M pneumoniae, although a ... function of a protein, additional information about post-translational modifications, like 2895 Signal peptidase I activity in M pneumoniae Fig SIGNAL P predicted and experimentally verified cleavage site ... asparagine at position 26 and the arginine at position 455 we calculated for P40 a molecular mass of 44.873 kDa As the molecular mass of P40 in protein extracts, measured by SDS ⁄ PAGE is about...
- 9
- 559
- 1
Tài liệu Báo cáo Y học: Receptor crosstalk Implications for cardiovascular function, disease and therapy ppt
Ngày tải lên :
21/02/2014, 15:20
... AC-mediated cAMP synthesis [1,2] AC-mediated cAMP synthesis [2,55] AC inhibition [2,87] ADO A1 A2 A A2 B A3 Brain, heart Pacemaker VSM, brain Heart, kidney Bradycardia Vasodilatation VSM relaxation ... ET-1 NO ANP via ANPR ET-1 stimulated ETA Ang II via AT1R ANP Isoproterenol-activated b-AR NO a1 -AR agonist (PE) b-AR agonists (IPN) Ang II-activated AT1R eNOS ET-1-activated ETA M1/M2 stimulation ... in adult rat myocytes [66] b1-AR Ang II via AT1R ET-1 via ETA a1 -AR agonist (PE) Gi-coupled a1 -AR (NE) Ang II on (neuronal) AT1R AT1R -antagonists Ang II-stimulated AT2R ET-1 NO via eNOS NO via...
- 18
- 621
- 0
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx
Ngày tải lên :
05/03/2014, 12:20
... intonation to Vietnamese EFL learners The pronunciation mistakes made by people learning to speak a foreign language are almost always carry-overs from their native languages Through a comparison ... used as the native language and English as the target language The Vietnamese word structure and the Vietnamese tones, intonation Generally, there are two aspects in Vietnamese that make the language ... statements, grammatical subordination Fourth, intonation can signal to the listener what is to be taken as “new” information and what is already “given”, can suggest where the speaker is indicating...
- 10
- 2K
- 17
A Meta-Analysis of Fear Appeals: Implications for Effective Public Health Campaigns pdf
Ngày tải lên :
05/03/2014, 22:21
... successes and failures of fear appeals, and fear is reincorporated as a central variable in the model According to the EPPM, the evaluation of a fear appeal initiates two appraisals of the message, which ... fear or threat in a message were retained for analysis To be included in this meta-analysis, fear appeal studies needed to manipulate fear or threat in a fear appeal message (i.e., there had ... Mongeau8 and 35 in Mongeau9) An explanation for this is that far fewer studies are focusing on fear manipulations and are instead focusing on threat manipulations, with fear being measured as a...
- 25
- 486
- 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
Ngày tải lên :
07/03/2014, 17:20
... (5¢-GGCCTCATGAAGAAAAAGGTCGTCA TAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA ... shown that NADH is available to be used ‘on demand’ when a substrate appears while at the same time avoiding the stabilization of a reduced flavin intermediate that could react undesirably with ... acting as a CoADR This is only the second demonstrated CoA reductase activity, and the first appearance of this activity in both the Archaea and in a strict anaerobe While the best known small molecular...
- 12
- 420
- 0