immunology of head and neck cancer
Regular recreational physical activity and risk of head and neck cancer
... carcinoma of the head and neck, including cancers of the oral cavity, oropharynx, hypopharynx, and larynx; 2) no history of any type of cancer diagnosis; and 3) between the age of 20 and 80 Controls ... stated Lin et al BMC Cancer (2017) 17:286 Background Head and neck cancer (HNC) (cancers of the oral cavity, oropharynx, hypopharynx, and larynx) is the fifth leading cancer in the world, with ... additional adjustment for Lin et al BMC Cancer (2017) 17:286 Page of 10 Table Demographic and lifestyle characteristics of the head and neck cancer patients and control subjects Characteristics
Ngày tải lên: 19/09/2020, 21:40
Evaluation of hypoxia in a feline model of head and neck cancer using 64Cu-ATSM positron emission tomography/computed tomography
... Ballegeer et al BMC Cancer 2013, 13:218 http://www.biomedcentral.com/1471-2407/13/218 RESEARCH ARTICLE Open Access Evaluation of hypoxia in a feline model of head and neck cancer using 64Cu-ATSM ... middle, and transverse plane on the right A similar area of transection through the head in each plane was chosen between two time points, using anatomic landmarks of the orbit, mandibular rami, and ... The location of the mass, maximum dimension of the mass, Tmax/M, Tav/M and pO2 in three tumor regions are provided HNSCC = head and neck squamous cell carcinoma Ballegeer et al BMC Cancer 2013,
Ngày tải lên: 05/11/2020, 06:22
parathyroid hormone like hormone is a poor prognosis marker of head and neck cancer and promotes cell growth via runx2 regulation
... proliferation, and differentiation in endochondral bone formation process13,14 and is an important transcription factor in breast and prostate cancer development and progression15 In breast cancer cells and ... trait of cancer cells is the uncontrolling cell growth1 Cancer cells harbor numerous genetic changes to maintain proliferation abilities and resist cell death signals or growth suppressors Head and ... Taipei, Taiwan 4Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan Department of Otolaryngology, Head and Neck Collaborative Oncology Group,
Ngày tải lên: 04/12/2022, 15:59
Dietary-phytochemical mediated reversion of cancer-specific splicing inhibits Warburg effect in head and neck cancer
... expression of BORIS in (d) Ye Head- Neck and (e) Slebos Head- Neck cancer analyzed by using Oncomine database (f) Western blot showing the protein level of PKM2, PKM1, and BORIS in paired normal and tumor ... of BORIS and its role in exon-10 inclusion in breast cancer [14] PKM2-isoform has been found to be overexpressed in cancer cells [5] and is a key regulator of the Warburg effect and thereby cancer ... and lactate production and thereby reduced growth, invasion and increased apoptosis of head- and- neck cancer cells The observed effect of curcumin on alternative splicing of PKM gene together with
Ngày tải lên: 17/06/2020, 18:58
Feasibility and acceptability of combining cognitive behavioural therapy techniques with swallowing therapy in head and neck cancer dysphagia
... Research and Treatment of Cancer – Head and Neck module; EORTC-QLQ: European Organization for Research and Treatment of Cancer- Quality of Life Questionnaire; HADS: Hospital Anxiety and Depression ... development and validation of a dysphagia-specific quality -of- life questionnaire for patients with head and neck cancer: the M D Anderson dysphagia inventory Archives of Otolaryngol Head Neck Surg ... Lefebvre JL Best practices in the management of the psycho-oncologic aspects of head and neck cancer patients: recommendations from the European head and neck cancer society make sense campaign Ann
Ngày tải lên: 23/07/2020, 23:44
Progressive resistance training in head and neck cancer patients during concomitant chemoradiotherapy – design of the DAHANCA 31 randomized trial
... Denmark (protocol id: H-15003725) and registered retrospectively at ClinicalTrials.gov (NCT02557529) September 11th 2015 Keywords: Head and neck cancer, Head and neck squamous cell carcinoma, Chemoradiotherapy, ... At the Departments of Oncology at Herlev and Aarhus University Hospitals, patients with stage III/IV squamous cell carcinoma of the head and neck, scheduled for CCRT are randomized 1:1 to either ... 31 randomized trial Camilla K Lonkvist1, Simon Lønbro2,3, Anders Vinther4, Bo Zerahn5, Eva Rosenbom6, Hanne Primdahl7, Pernille Hojman8 and Julie Gehl1* Abstract Background: Head and neck cancer
Ngày tải lên: 06/08/2020, 07:25
Swallowing interventions for the treatment of dysphagia after head and neck cancer: A systematic review of behavioural strategies used to promote patient adherence to swallowing exercises
... swallowing interventions, and to explore any relationships between these strategies and intervention effects Randomised and quasi-randomised studies of head and neck cancer patients were included ... EORTC: European Organisation of Research and Treatment of Cancer; FOIS: Functional oral intake scale; HNC: Head and neck cancer; MBS: Modified barium swallow; MDADI: MD Anderson Dysphagia Inventory; ... were adults Page of 15 diagnosed with head and neck cancer; treated via one of the key treatment modalities of surgery, radiotherapy, chemo-radiotherapy or combinations thereof Interventions
Ngày tải lên: 20/09/2020, 01:02
HSP90 inhibition sensitizes head and neck cancer to platin-based chemoradiotherapy by modulation of the DNA damage response resulting in chromosomal fragmentation
... sensitive to cisplatin, RT and CCRT alone and in combination with HSP90i Loss of ATM has been shown to occur in head and neck due to loss of the distal region of chromosome 11q [44] Much discussion ... and and in the context of the literature as outlined in the discussion the highest levels of DDR signalling due to CCRT and the highest levels of chromosomal fragmentation with the addition of ... Institute of Cancer Research London to Vernalis Ltd and Novartis The Institute of Cancer Research London has benefited from this and requires its employees to declare this potential conflict of interest
Ngày tải lên: 20/09/2020, 01:18
Molecular analyses of unselected head and neck cancer cases demonstrates that human papillomavirus transcriptional activity is positively associated with survival and prognosis
... S The prevalence of human papillomavirus in oropharyngeal and nonoropharyngeal head and neck cancer: a systematic review and meta-analysis of trends by time and region Head Neck 2013;35:747–55 ... role of human papillomavirus in squamous cell carcinoma of the temporal bone Head Neck Oncol 2013;5:22 46 Fakhry C, Gillison ML Clinical implications of human papillomavirus in head and neck cancers ... carcinomas Head Neck 2001;23:147–59 42 Nodzenski E, Brachman D, Mick R, Montag A, Graves D, Vokes EE, Weichselbaum RR Human papilloma virus and p53 in head and neck cancer: clinical correlates and survival
Ngày tải lên: 21/09/2020, 01:35
Proteoglycan-based diversification of disease outcome in head and neck cancer patients identifies NG2/CSPG4 and syndecan-2 as unique relapse and overall survival predicting factors
... University Hospital in Bologna and at the Maxillo-Facial Surgery Division, Department of Head and Neck Surgery of the University of Parma A total of 173 surgical specimens of primary oral cavity HNSCC ... BMC Cancer (2015) 15:352 DOI 10.1186/s12885-015-1336-4 RESEARCH ARTICLE Open Access Proteoglycan-based diversification of disease outcome in head and neck cancer patients identifies NG2/CSPG4 and ... predictors of poor prognosis (i.e T classification, previous occurrence of precancerous lesions and lymphnodal metastasis) Combined alteration of all three PGs was found to be a reliable predictor of
Ngày tải lên: 29/09/2020, 16:16
Diagnostic value of retrospective PET-MRI fusion in head-and-neck cancer
... PET and of MRI alone for locoregional tumour and nodal staging of head- and- neck cancer Methods: Thirty-three patients with head- and- neck cancer underwent preoperative contrast-enhanced MRI and PET/ ... type and extent of surgical resection of the tumour and the type of the neck dissection was determined by our head- and- neck surgical team on the basis of staging results and estimated risk of occult ... analysis, Head- and- neck cancer, Staging Background Clinical examination and imaging is routinely performed for the staging of head- and- neck cancer (HNC) in order to establish the tumour extent and
Ngày tải lên: 30/09/2020, 15:04
focal overexpression of ceacam6 contributes to enhanced tumourigenesis in head and neck cancer via suppression of apoptosis
... Background: Overexpression of CEACAM6 has been reported for a number of malignancies However, the mechanism of how CEACAM6 contributes to cancer formation and its role in head and neck squamous cell ... top strand and bottom strand was 5’ GTCAATAGTGAGTGGCAGTG 3’ The other miR RNAi sequence for CEACAM6 was named miR CEA Dux, with a top strand of 5’ CCGGACAGTTCC ATGTATACC 3’ and bottom stand of 5’ ... overexpression of CEACAM6 contributes to enhanced tumourigenesis in head and neck cancer via suppression of apoptosis Molecular Cancer 2012 11:74 Submit your next manuscript to BioMed Central and take
Ngày tải lên: 02/11/2022, 10:46
Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx
... radiation therapy of head and neck cancer. Expert Rev Anticancer Ther 2008, 8:633-644. 4. Li Y, Ten Haken R, Eisbruch A: The impact of dose on parotid recovery in head and neck cancer patients ... therapy for head and neck carcinoma. The Oncologist 2007, 12:555-564. 2. Lee N, Puri D, Blanco AI, Chao KS: Intensity modulated radiathion therapy in head and neck cancers: an update. Head and Neck ... , Filippo Alongi 1 , Armando Santoro 1 Abstract Background: To report about early clinical experience in radiation treatment of head and neck cancer of different sites and histology by volumetric
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: " IMRT using simultaneously integrated boost (SIB) in head and neck cancer patients" pps
... chemotherapy in advanced head and neck cancer Experience from four nonrandomized... therapy in head and neck cancers: dosimetric advantages and update of clinical results Am J ... in advanced head and neck. .. Selection and delineation of lymph node target volumes in head and neck conformal radiotherapy Proposal for standardizing terminology and procedure ... 32 mous cell head and neck cancer: preliminary results Head. .. therapy) boost: a new accelerated fractionation schedule for the treatment of head and neck cancer with intensity
Ngày tải lên: 09/08/2014, 10:20
Nanoparticle based targeted therapeutics in head-and-neck cancer
... Expression Of Folate Receptor In Squamous Cell Carcinoma Of the Head And Neck as a Target for a Novel Nanotherapeutic Drug Head And Neck- Journal for the Sciences And Specialties Of the Head And Neck ... smoking in never drinkers, and the risk of head and neck cancer: Pooled analysis in the international head and neck cancer epidemiology consortium Journal Of the National Cancer Institute 2007; 99: ... cell carcinoma of the head and neck Mol Med 1995; 1: 659-66 56 Brown MS, Diallo OT, Hu M, et al CK2 modulation of NF-kappaB, TP53, and the malignant phenotype in head and neck cancer by anti-CK2
Ngày tải lên: 15/01/2020, 16:59
Increased expression of LAMTOR5 predicts poor prognosis and is associated with lymph node metastasis of head and neck squamous cell carcinoma
... resistance in head and neck cancers harboring PIK3CA and RAS mutations Journal of the National Cancer Institute 2014; 106 Ferris RL Immunology and Immunotherapy of Head and Neck Cancer Journal of clinical ... management of head and neck cancer - impact of pembrolizumab Therapeutics and clinical risk management 2018; 14: 295-303 26 Pandey M, Kannepali KK, Dixit R, Kumar M Effect of neoadjuvant chemotherapy and ... biology of head and neck cancer Nature reviews Cancer 2011; 11: 9-22 Guan GF, Zhang DJ, Wen LJ, Xin D, Liu Y, Yu DJ, et al Overexpression of lncRNA H19/miR-675 promotes tumorigenesis in head and neck
Ngày tải lên: 15/01/2020, 18:14
Ebook Clinical atlas of head and neck anatomy: Part 2
... 27, 31, 43, 143 Handle of malleusl49,I5I Head of caudatenucleus197,193 - of malleus149,l5l - of mandible35, 111,117,209 - of pterygoidmuscle117 - of rib 85, 89 - of stapes151 - of sternocleidomastoid ... gland Submandibularduct c Isolated left parotid gland and the mandible' from the medial side (For the lateral surfaceof the gland seepage 112) D Isolated right sublingual and submandibular glands ... $ivpjon ] of retromandibularvein Anterror cllvrsron ) Ramus of mandible Accessoryparotid gland Parotid duct Lower secondmolar tooth Sublingual gland Submandibularduct Mylohyoid line of body of mandible
Ngày tải lên: 20/01/2020, 06:25
Tài liệu Diagnosis and management of head and neck cancer docx
... diagnosis and management of head and neck cancer Overview of treatment of the primary tumour and neck This section addresses the first line treatment of head and neck cancer Management of recurrent ... the recognition and management of acute and late radiation toxicity 29 diagnosis and management of head and neck cancer 10 Treatment: palliation of incurable disease Head and neck cancer may be ... 1.3.3 oropharyngeal cancer Oropharyngeal cancer includes tumours of the:4 base of tongue tonsil soft palate diagnosis and management of head and neck cancer 1.3.4 oral cavity cancer Oral cavity cancer...
Ngày tải lên: 14/02/2014, 22:20
Pocket Guide To TNM STAGING OF HEAD AND NECK CANCER AND NECK DISSECTION CLASSIFICATION pdf
... Guide to NECK DISSECTION CLASSIFICATION AND TNM STAGING OF HEAD AND NECK CANCER Committee for Head and Neck Surgery and Oncology American Academy of Otolaryngology– Head and Neck Surgery Neck Dissection ... of: Pocket guide to neck dissection classification and TNM staging of head and neck cancer / Committee for Neck Dissection Classification, American Head and Neck Society [and] Committee for Head ... III Sharma, Anand K IV Kies, Merrill S V American Academy of Otolaryngology Head and Neck Surgery Committee for Head and Neck Surgery and Oncology VI American Head and Neck Society Neck Dissection...
Ngày tải lên: 15/03/2014, 00:20