immunocyto�chemical assay for detection of androgen receptor ar part a

Electrical porous silicon chemical sensor for detection of organic solvents

Electrical porous silicon chemical sensor for detection of organic solvents

... Characterization of silicon surface preparation processes for advanced gate dielectrics, IBM J Res Dev 43 (1999) 351–365 [22] A Nakajima, T Itakura, S Watanabe, N Nakayama, Photoluminescence of ... M Kawakami, H Aoyagi, A Kinoshita, A Satou, Identification of water molecules in low humidity and possibility of quantitative gas analysis using porous silicon gas sensor, Jpn J Appl Phys., Part ... to (a) chloroform, (b) acetone, (c) ethanol, and (d) acetonitrile In each case 10 ␮l of the solvent was added at a time indicated by the black arrow change in capacitance (% C) and conductance...

Ngày tải lên: 16/03/2014, 15:23

11 402 0
Tài liệu FUZZY CLUSTERING ALGORITHMS ON LANDSAT IMAGES FOR DETECTION OF WASTE AREAS: A COMPARISON pdf

Tài liệu FUZZY CLUSTERING ALGORITHMS ON LANDSAT IMAGES FOR DETECTION OF WASTE AREAS: A COMPARISON pdf

... http://www.ge.infm.it/∼massone/TELEMA results presented in this paper are available at Legend Forest areas Cultivated areas Shadow Urban areas Quarry and waste areas (a) (b) (c) (d) Figure 3: Segmentations obtained using HCM (a) , ... combinations of three bands Among the possible combinations of Landsat bands, the most significant for our aims have been: The bands 4, and which allow the discrimination of urban areas from forest areas ... and K-Nearest Neighbour [4] The supervised methods were trained over five areas extracted by a photo-interpreter, each characterizing a specific class: shadow, waste/quarry, urban area, cultivated...

Ngày tải lên: 16/01/2014, 16:33

11 371 0
Tài liệu Báo cáo khoa học: "Automatic Extraction of Lexico-Syntactic Patterns for Detection of Negation and Speculation Scopes" pdf

Tài liệu Báo cáo khoa học: "Automatic Extraction of Lexico-Syntactic Patterns for Detection of Negation and Speculation Scopes" pdf

... in the task of identifying negation and speculation scopes has developed in recent years Rele286 vant research was facilitated by the appearance of a publicly available annotated corpus All systems ... algorithm for identifying negated findings and diseases in discharge summaries Journal of biomedical informatics, 34(5):301–310 A. B Clegg and A. J Shepherd 2007 Benchmarking natural-language parsers ... Computational Natural Language Learning (CoNLL2010): Shared Task, pages 1–12 H Kilicoglu and S Bergler 2008 Recognizing speculative language in biomedical research articles: a linguistically motivated...

Ngày tải lên: 20/02/2014, 04:20

5 544 1
Xpert MTB/RIF test for detection of pulmonary tuberculosis and rifampicin resistance (Protocol) pptx

Xpert MTB/RIF test for detection of pulmonary tuberculosis and rifampicin resistance (Protocol) pptx

... (number of contaminated cultures/total number of cultures performed) x 100 We will contact authors of primary studies for missing data or clarifications All data will be entered into a database manager ... RevMan by “year of study” to look for a trend with time, since software and cartridge changes have been made to improve the specificity for rifampicin detection Where sufficient data are available, ... bias will be minimal col We will address these outcomes in a section of the discussion and present summary data in additional tables In addition, if data are available, we will prepare a qualitative...

Ngày tải lên: 06/03/2014, 04:20

23 506 0
Báo cáo khoa học: Piezoelectric sensors based on molecular imprinted polymers for detection of low molecular mass analytes potx

Báo cáo khoa học: Piezoelectric sensors based on molecular imprinted polymers for detection of low molecular mass analytes potx

... overall assay performance of MIPs and as there is no general procedure for MIP preparation, each template requires optimization of several parameters to fabricate reproducible, high-performance ... binder and peptide-immobilized latex beads Anal Chim Acta 469, 183–188 Karousos NG, Aouabdi S, Way AS & Reddy SM (2002) Quartz crystal microbalance determination of organophosphorus and carbamate ... imprinting and its application for the determination of paracetamol in the human serum and urine Talanta 55, 337–347 59 Yan S, Fang Y & Gao Z (2007) Quartz crystal microbalance for the determination of...

Ngày tải lên: 23/03/2014, 07:20

10 567 1
STUDY ON EPIDEMIOLOGICAL FEATURES, APPLICATION OF DIAGNOSTIC KIT FOR DETECTION OF TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN CATTLE AND BUFFALOES IN A FEW NORTHERN MOUNTAINOUS PROVINCES AND RECOMMENDATION FOR PREVENTIVE AND TREATMENT MEASURES

STUDY ON EPIDEMIOLOGICAL FEATURES, APPLICATION OF DIAGNOSTIC KIT FOR DETECTION OF TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN CATTLE AND BUFFALOES IN A FEW NORTHERN MOUNTAINOUS PROVINCES AND RECOMMENDATION FOR PREVENTIVE AND TREATMENT MEASURES

... evansi are higher than that of healthy mice * In rabbits: - Appearance time of T evansi in the blood of rabbit earliest on day and latest on day 14 after being experimentally infected Appearance ... evansi all appear clinical signs with percentage of 20 - 100 % - In trypanosome infected buffaloes there are apparently decreased amount of erythrocytes and increased amount and rates of granulocytes ... clearly including pericardial cavity accumulated with a lot of fluid, dilation of various layers of heart muscle; dilated hepatic portal vein, degenerative hepatocytes; congested lungs; hemorrhagic...

Ngày tải lên: 28/04/2014, 13:08

14 590 0
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc

báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc

... PBMC was evaluated Calibration standard curve and linearity of dilution Due to the lack of a standard reference material, calibration standard curves were not evaluated for quantification of cellular ... in cancer patients, few of these assays are validated when used for clinical applications [1,3,11,12] Furthermore, the validation of immunoassays was identified as one of the critical areas for ... preparation for our cancer vaccine clinical trials These assays met key validation criteria necessary for generating reliable clinical data The assays were determined to be specific for each antigen,...

Ngày tải lên: 18/06/2014, 15:20

25 640 0
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

... employed for the determination of JC viral load A – C: Analysis of HA and quantitative real-time PCR data employed for the determination of JC viral load JCV (Mad1), propagated in Dr Walker's laboratory ... between real-time PCR and HA assays for the determination of JC viral load JCV(Mad1) was propagated in primary human fetal glial (PHFG) cells and purified in Dr Duard Walker's laboratory (I) ... Optical System Software Version 3.1 A standard curve for the quantitation of JCV was constructed using serial dilutions of the linearized JCV(Mad1) plasmid The dynamic range of detection was determined...

Ngày tải lên: 19/06/2014, 08:20

5 358 0
báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx

báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx

... employed for the determination of JC viral load A – C: Analysis of HA and quantitative real-time PCR data employed for the determination of JC viral load JCV (Mad1), propagated in Dr Walker's laboratory ... between real-time PCR and HA assays for the determination of JC viral load JCV(Mad1) was propagated in primary human fetal glial (PHFG) cells and purified in Dr Duard Walker's laboratory (I) ... Optical System Software Version 3.1 A standard curve for the quantitation of JCV was constructed using serial dilutions of the linearized JCV(Mad1) plasmid The dynamic range of detection was determined...

Ngày tải lên: 20/06/2014, 04:20

5 327 0
Báo cáo hóa học: " Improvement for detection of microcalcifications through clustering algorithms and artificial neural networks" ppt

Báo cáo hóa học: " Improvement for detection of microcalcifications through clustering algorithms and artificial neural networks" ppt

... models of the brain ANNs are used in a wide variety of data processing applications where real-time data analysis and information extraction are required One advantage of the ANNs approach is that ... 28040 Madrid, Spain 2University of Guadalajara, 45101 Zapopan Jalisco, Mexico 3University of Guanajuato, 36885 Salamanca Guanajuato, Mexico Competing interests The authors declare that they have ... field An ANN can approximate the function of multiple inputs and outputs As a consequence, ANNs can be used for a variety of applications, among which are classification in medical applications...

Ngày tải lên: 20/06/2014, 22:20

11 437 0
Báo cáo hóa học: " Track-before-detect procedures for detection of extended object" potx

Báo cáo hóa học: " Track-before-detect procedures for detection of extended object" potx

... the radar is located at the origin and the system parameter is ΔT = 0.1s, a = 1°, Δr = m, Nr = 3000, and Na = 60 The total number of scan simulated is 30, and a target appears at scan k = at initial ... initial location [9520 9040] m with a constant velocity of [-507 -390] m/s towards the radar and disappears at scan k = 21 The target length is ℓ = 20 m and the target may occupy as much as four ... absence of a target, the random variable modeled by a two-state Markov chain, i.e., Ek Î {0,1}, is used [14-16], where Ek = means the target is present and Ek = means the target is absent The Markov...

Ngày tải lên: 21/06/2014, 01:20

6 261 0
Báo cáo hóa học: " Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids" pot

Báo cáo hóa học: " Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids" pot

... http://www.nanoscalereslett.com/content/6/1/385 characterization LT treated electrochemical data and participated in preparation of the manuscript VA participated in the design of the study and performed the analysis of the data RK conceived ... Prasek et al Nanoscale Research Letters 2011, 6:385 http://www.nanoscalereslett.com/content/6/1/385 A Page of B Figure Preparation and characterization of MWCNTs (A) Set-up of the apparatus for ... single strand from influenza (ODN influenza; 5’-CAG TCG CAA GGA CTA ATC TGT TTG-3’) were analysed Carbon and/or graphite are of particular interest but its voltammetric response is complex as a result...

Ngày tải lên: 21/06/2014, 03:20

5 383 0
báo cáo hóa học:" Research Article Jitter Estimation Algorithms for Detection of Pathological Voices" doc

báo cáo hóa học:" Research Article Jitter Estimation Algorithms for Detection of Pathological Voices" doc

... model for jitter mentioned above The algorithm is based on mathematical attributes of the magnitude spectrum; the train of impulses can be separated in a harmonic part (H) and subharmonic part ... larger variance) To see how the tools behaved in a completely different databases we also performed the evaluation on the DB02 database This database, although smaller, had the advantage EURASIP ... performing an LPC analysis on a sustained vowel produced by a male speaker, with a fundamental frequency of around 144 Hz, and using an analysis frame size of glottal periods As expected, the algorithm...

Ngày tải lên: 21/06/2014, 20:20

9 348 0
Báo cáo hóa học: " Research Article An Algorithm for Detection of DVB-T Signals Based on Their Second-Order Statistics" doc

Báo cáo hóa học: " Research Article An Algorithm for Detection of DVB-T Signals Based on Their Second-Order Statistics" doc

... The proof is given in the appendix Remark Note that if the condition, that all the carriers are used to transmit data, is not satisfied, some additional terms appear in (5) and the demonstration ... impact of this parameter on the mean and on the variance of J y (Nb ) under both assumptions NUMERICAL EVALUATION OF THE PERFORMANCES OF THE PROPOSED ALGORITHMS We now give some numerical estimation ... signal are asymptotically normal with mean and variance σ /U Furthermore, these cycle coefficients are asymptotically uncorrelated, and hence mutually independent The proof is given in the appendix...

Ngày tải lên: 22/06/2014, 06:20

9 255 0
Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps

Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps

... Arthritis Research & Therapy Vol 11 No Siala et al Introduction Materials and methods The actual pathogenic event initiating arthritis is largely unknown For several forms of arthritis, an ... etiology has been postulated [1-3] In particular, reactive arthritis (ReA) is known to be triggered by a variety of bacteria For Salmonella, Yersinia, and Chlamydia, a persistent infection has been ... suggesting that these new bacteria possibly could have a pathogenic relevance, particularly with regard to the ST The detection of such a variety of bacterial groups after cloning and near fulllength...

Ngày tải lên: 09/08/2014, 14:22

11 462 0
Báo cáo khoa hoc:" Bayes factors for detection of Quantitative Trait Loci" pot

Báo cáo khoa hoc:" Bayes factors for detection of Quantitative Trait Loci" pot

... the variables observed by Garc a- Cortộs et al [6], after integrating out the random effects This fact represents a great advantage over other 148 L Varona et al Table VII Mean (Standard Deviation) ... calculated at positions of 10, 30 and 50 cM The Bayes factor was computed from the output of a Gibbs Sampler using the argument of Rao-Blackwell, as before The calculation of Q matrix was performed ... for each of the four different cases of simulation Stability Analysis Two replicates of case II (10% of variation was located on the QTL) were analyzed 000 times with Monte Carlo chains of 20,...

Ngày tải lên: 09/08/2014, 18:21

20 393 0
Báo cáo y học: "Hedgehog overexpression leads to the formation of prostate cancer stem cells with metastatic property irrespective of androgen receptor expression in the mouse model" pps

Báo cáo y học: "Hedgehog overexpression leads to the formation of prostate cancer stem cells with metastatic property irrespective of androgen receptor expression in the mouse model" pps

... 101:12561-12566 19 Karhadkar SS, Bova GS, Abdallah N, Dhara S, Gardner D, Maitra A, Isaacs JT, Berman DM, Beachy PA: Hedgehog signalling in prostate regeneration, neoplasia and metastasis Nature 2004, ... controls, AR was predominantly located in the nucleus of luminal cells (Figure 4A; (d); indicated by arrowhead) and of some basal cells (Figure 4A; (d); arrow (1) indicated AR+ basal cells and arrow ... indicated by arrowheads) and particularly evident in the round-shaped or accumulated basal cells (indicated by arrowheads in the magnified areas of Figure 2F to 2J), in contrast to the normal slim...

Ngày tải lên: 10/08/2014, 05:21

11 446 0
Báo cáo y học: "Structure of HIV-1 quasi-species as early indicator for switches of co-receptor tropis" docx

Báo cáo y học: "Structure of HIV-1 quasi-species as early indicator for switches of co-receptor tropis" docx

... contributed to data analysis and to drafting of the manuscript D Hoffmann has devised research, analyzed data, and revised the manuscript All authors read and approved the final manuscript Competing ... T-CUP analysis of deep sequencing data generates a practically continuous (fraction of X4 tropic virus in quasi-species in units of 1/(number of reads)) The latter allows for a more detailed characterization ... Number of unique sequences used in the analysis for each patient and each of the three sample times Based on the data provided by Tsibris et al., a cutoff of a minimum of reads per sequence was applied...

Ngày tải lên: 10/08/2014, 05:21

5 321 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... routine physical exams, and the donors had an average age of 42 years (ranging from 30 to 61 years) They had normal blood cell counts and were apparently healthy Using the traditional nested AS-PCR ... Health, a grant from Oklahoma Center for the Advancement of Science & Technology (to ZJ Zhao) Page of Author details Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma...

Ngày tải lên: 10/08/2014, 21:23

7 436 0
Báo cáo y học: "Threshold for detection of diabetic peripheral sensory neuropathy using a range of research grade monofilaments in persons with Type 2 diabetes mellitu" pot

Báo cáo y học: "Threshold for detection of diabetic peripheral sensory neuropathy using a range of research grade monofilaments in persons with Type 2 diabetes mellitu" pot

... test was clearly explained to the participant, and a monofilament was demonstrated on the inside of the investigator's forearm and then repeated at the same site on the participant They were asked ... software Comparison of gender was tested by Chi-square and demographic, anthropometric and biochemical data between the three groups were tested by one way analysis of variance (ANOVA) Monofilament ... Comparison participants The numbers of participants in each group able to perceive the 6-gram monofilament at all sites increased again: 64% NEW; 48% EST and 90% Comparison Figur e The percentage...

Ngày tải lên: 10/08/2014, 21:23

7 309 0
w