immobilization of glucoamylase on yeast cell surface using a multicopy plasmid

... attachment to CAR, a 46-kDa transmembrane protein that also serves as a receptor for many adenoviruses [17] In addition, some strains of CVB1, and can interact with an additional receptor, DAF, ... amounts of cells and viruses Statistical analyses Individual data pairs were analysed by the unpaired t test, and one-way analysis of variance followed by Dunnetts post-test was used to compare ... study interaction using a limited amount of cells was also investigated A decreasing number of cells were incubated with CVB5 at a concentration of MOI 0.05 TCID50 /cell and significant differences...

Ngày tải lên: 12/08/2014, 04:21

... replacements (Table 1) that clustered in a characteristic manner (Fig 2) The mutation P236L was represented five times, leaving a total of 15 unique single mutations One mutant had a point mutation in ... premature translation termination, either by generating a stop codon or a frame shift leading to a stop some codons further downstream As the newly isolated mutations not hit all residues that ... distribution of mutations may suggest that the Ó FEBS 2004 outside face is mainly important for transport and the inside face for control, at least in the case of the somewhat unusual Fps1 Some mutations,...

Ngày tải lên: 07/03/2014, 15:20

... transcription almost completely Transporter expression in 293 cells was assayed functionally by initial rates of uptake of substrates; initial rates of uptake are directly proportional to transporter ... constructed from at least six standards which were prepared using control cell lysates as solvent Sample analyte content was calculated from the analyte response ratio and the slope of the calibration ... Regulation of expression of the human organic cation transporter type (OCT1h), which also resides in the plasma membrane Transporter expression in 293 cells was assayed by initial rates of uptake...

Ngày tải lên: 23/03/2014, 09:21

... (Annexin V+, 7AAD-) and (B) late stages of apoptosis (Annexin V+, 7AAD+); (C) CD8 lymphocytes in early stages of apoptosis (Annexin V+, 7AAD-) and (D) late stages of apoptosis (Annexin V+, 7AAD+) ... normalized by division of the raw data by the donor value at RT for 24 h Since donors served as blocks and contributed an observation from each condition (i.e each combination of temperature and ... training and quality assurance to confirm comparable methods and results Though it is an option, this approach often is infeasible for financial and organizational reasons Thus, it is common...

Ngày tải lên: 18/06/2014, 19:20

... in each borax concentration was carried out in duplicate fashion Mean absorbance was calculate for the control wells and for each borax concentration in the test wells The degree of immune cell ... borax at final concentration of 0.1, 0.15, 0.2, 0.3 and 0.6 mg/ml for 24 hours The value of mean absorbance reflected the anti-proliferation of lymphocyte by borax Mean absorbance conversion can ... 19 National Coalition Against the Mis-Use of Pesticides (NCAMP): “Least Toxic Pesticides-Borates” Washington DC 2001 Murray FJ: A Human Health Risk Assessment of Boron (Boric Acid and Borax)...

Ngày tải lên: 20/06/2014, 00:20

... conditional mean minimizes the mean square error of prediction, and because selection based on the conditional mean maximizes the mean of the selected candidates [2, 13], the conditional mean ... evaluations obtained from the same data sets METHODS 2.1 Notation Consider a trait determined by N segregating quantitative trait loci (QTL) with two alleles at each locus in a population of ... genotypic variance covariance matrix; C = GZ is the covariance matrix between u and y’; V = ZGZ + Iσ2 is the variance covariance matrix of y Under multivariate e normality the conditional mean is also...

Ngày tải lên: 14/08/2014, 13:22

... saline PECAM-1 platelet endothelial cell adhesion molecule-1 xii PLA proximity ligation assay qPCR quantitative polymerase chain reaction RIPA radio immunoprecipitation Assay ROCK Rho-associated protein ... production Cell viability unchanged Increase ROS production (for NPs) Activation of MAPK pathway (Park et al., 2008) (Sayes et al., 2006) (Monteiller et al., 2007) (Bhattacharya et al., 2009) (Kang ... span of a rat (Oberdorster et al., 1994) In summary, inhalation, ingestion, and dermal penetration could be considered as the entry points of TiO2-NPs in the context of occupational and environment...

Ngày tải lên: 09/09/2015, 08:17

... Narayana, Performance evaluation of cross ow compact heat exchangers using ÿnite elements, Int J Heat and Mass Transfer 32 (1989) 889–894 [11] S.G Ravikumar, K.N Seetharamu, P .A Aswatha Narayana, ... S.G Ravikumar, K.N Seetharamu, P .A Aswatha Narayana, Analysis of compact heat exchangers using ÿnite element method, in: Proceedings of the 8th International Heat Transfer Conference, Vol 2, San ... = − and N2 = (3) A A and A is the area at any given location which varies from zero to A where A is the area of an element Applying this approximation to governing equation (1), two equations...

Ngày tải lên: 19/03/2016, 13:14

... “Regulation of medical waste management” of the Ministry of Public Health, medical waste must be treated immediately at once, contained in bag or barrel according to color and standard In fact, ... strict regulations and supervisions It is shown that out of 400 tons of medical wastes, there are 50 tons that are dangerous and non-recyclable This means that about 87% of medical wastes can be recycled ... raised through various ways, ranging from propaganda, education and dissemination of information Having acknowledged the jeopardy of medical wastes, everyone, especially the medical staffs, who sold...

Ngày tải lên: 23/09/2012, 15:38

... apparatus was made by adding magnesium and adjusting the pH, and new MAP was made to form on the surface of the MAP particles already in the reactor The interior of the reactor was aerated using air ... with an ammonium concentration of about 200 mg/L and phosphorus concentration of about 100 mg/L MAP was formed by adding magnesium and adjusting the pH pH Settling tank The experimental apparatus ... 50 60 elapsed time　(d) raw water Compared to a T-P Figure Treatment conditions VS changes in the quality of concentration of 168 mg/L and a PO4-P of treated water along the elapse of days 149...

Ngày tải lên: 05/09/2013, 08:40

... Habeeb, S A. , AB Aziz Bin Abdul Latiff., Zawawi Bin Daud., Zulkifli Bin Ahmad A review on granules initiation and development inside UASB Reactor and the main factors affecting granules formation ... Ronnachai C, Piyarat B, Poonsuk P, Sumate C Effect of organic loading rate on methane and volatile fatty acids productions from anaerobic treatment of palm oil mill effluent in UASB and UFAF reactors ... mentioned parameters were analyzed according to the standard method of water and wastewater examination [10] The bacterial growth in sludge bed was also observed by using PAXcam system connected...

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 13/02/2014, 12:20

... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT ... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... Technologies, Santa Clara, CA, USA) was used for thermo- 1684 cycling and its software mxpro version 3.04b was used for data collection and analyses The coefficient of variation in the Ct values was obtained...

Ngày tải lên: 14/02/2014, 19:20

... correct shade for direct composite resin restorations and can serve as a practical chairside alternative to the diagnostic wax-up It can also be used to create a lingual matrix for multilayered ... material is then removed at the gingival margin using a #12 blade or a flame carbide or diamond bur The patient can immediately see and appreciate the proposed result The diagnostic mock-up can ... teeth shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic...

Ngày tải lên: 19/02/2014, 17:20

... Page of Figure SEM image of the Au coated carbon nanotube nanoneedle (a) Carbon nanotube nanoneedle before Au nanoparticle coating and (b) after Au nanoparticle coating (scale bar: μm) (c) Magnified ... spacing between the tungsten tips The Figure Schematic diagram of the nanoneedle fabrication process (a) A carbon nanotube nanoneedle using dielectrophoresis and (b) a functional material-coated ... the ionization state of all weak acids and weak bases and thus potentially affect a wide array of biological processes [29] The nanoneedle pH sensor enables measurement of intracellular pH [11]...

Ngày tải lên: 21/06/2014, 04:20

... Fabrication process of a nano-dot growth under As4 irradiation a applying voltage, b Ga-rich site fabrication, c congregating In atoms in this site, and d exceeding critical thickness partially, ... increase crystal quality of nano structure, we tried to fabricate at 430°C under As4 irradiation After the InAs WL growth at 500°C, a substrate temperature has decreased to 430°C under As4 irradiation ... Fig 1 (a ) In this image, any surface structure transition was not confirmed Then, similar observation was operated at 150°C A tip bias was ?1.0 V, a tunneling current was 0.2 nA, and the scan speed...

Ngày tải lên: 21/06/2014, 08:20

... additional signal shadowing standard deviation We conclude that the exponential variation of our relative span weighted localization algorithm achieves a location accuracy that meets the FCC regulations ... intersection of constructed hyperbolic areas suggests a candidate area for the location of a transmitter While open-form solutions may localize a node within an area with a suitable degree of granularity ... location of a given message may be approximated from the coordinates of receiving devices, assuming an omnidirectional propagation pattern We propose two localization algorithms that estimate a transmitting...

Ngày tải lên: 21/06/2014, 23:20

... consists of a microphone array and a camera array (PointGray Research, Ladybug-2) The microphone array is circular in shape with a diameter of 15 cm and consists of eight omnidirectional microphones ... Ikeda, M Ogawa, H Asoh, and N Kitawaki, “Combined approach of array processing and independent component analysis for blind separation of acoustic signals,” IEEE Transactions on Speech and Audio ... columns of “with AM adaptation,” unsupervised adaptation was conducted on the acoustic model (AM) of ASR For the adaptation, MLLR (maximum-likelihood linear regression) + MAP (maximum a posteriori)...

Ngày tải lên: 22/06/2014, 19:20

... (Luton, UK) Statistical analysis All data were expressed as the mean of the individual experiments ± the standard error of the mean Data were analysed using one-way or two-way analysis of variance ... variants in untreated EC (0 hours; Figure 4a) Quantification of mRNA using the 2.1 kB band indicated a mean ± standard deviation increase of 54 ± 17% after hours of stimulation with atorvastatin ... that cycles of hypoxia and reoxygenation within the synovium may also exacerbate complement activation In situ analysis has demonstrated abundant local synthesis of C3, C3aR, C5aR and C5b-9 at...

Ngày tải lên: 09/08/2014, 08:22