ii for hydrogen in the presence of a constant magnetic field

THE ACOUSTOMAGNETOELECTRIC CURRENT OF a RECT ANGULAR QUANTUM WIRE WITH AN INFINITE POTENTIAL IN THE PRESENCE OF AN EXTERNAL MAGNETIC FIELD

THE ACOUSTOMAGNETOELECTRIC CURRENT OF a RECT ANGULAR QUANTUM WIRE WITH AN INFINITE POTENTIAL IN THE PRESENCE OF AN EXTERNAL MAGNETIC FIELD

... understand the properties of quantum wire material We have obtained the AME current I in the RQW with an infinite potential in the presence of an external magnetic field The dependence of the expression ... Like the classical magnetic field, the effect also exists in the case of a quantized magnetic field, and the quantum acoustomagnetoelectric effects due to Rayleigh sound waves have investigated ... temperature and the large value range of the acoustic wave number qz The value of the AME current I is zero (the effect is not appear) when the small value range of the acoustic wave number qz and the...

Ngày tải lên: 30/10/2015, 20:58

7 216 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx

Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx

... indicating that the dominant effect of the Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin in the absence or presence of p-amindinobenzamidine (A) Effect of trypsinogen ... trypsinogen autoactivation in the presence of 100 lM p-amindinobenzamidine As seen in this figure, the presence of p-amindinobenzamidine lengthened the lag time considerably Similarly, the values of ... Trypsin catalyzes the activation of trypsinogen in an intermolecular autocatalytic process The conversion of trypsinogen to trypsin involves the removal of the N-terminal hexapeptide H2N-Val-AspAsp-Asp-Asp-Lys...

Ngày tải lên: 23/03/2014, 13:20

8 403 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the...

Ngày tải lên: 20/06/2014, 04:20

5 430 0
báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx

báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx

... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... displays the energy levels of a kink-antikink potential as function of an external magnetic field for (a) ky = and (b) ky = 0.2 For the kink-antikink case, the overlap between the states associated ... shift of the four mid-gap energy branches as the magnetic field increases In addition, the continuum of free states at zero magnetic field is replaced by a set of Landau levels for ε >ub The spinor...

Ngày tải lên: 21/06/2014, 02:20

10 471 0
báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx

báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx

... his stomach His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent to the gastrojejunostomy and a drain by the duodenal repair and his abdomen closed The drains were ... abdominal trauma in the presence of a large pancreatic pseudocyst Minor blunt abdominal trauma in a normal healthy adult would not be expected to result in any significant duodenal injury We acknowledge ... fistulas and intraabdominal abscesses were the main causes of morbidity [3] Most duodenal injuries can be managed by surgical repair [3] Non-operative management of duodenal perforations with intravenous...

Ngày tải lên: 10/08/2014, 23:20

4 251 0
ON THE HALL EFFECT IN PARABOLIC QUANTUM WELLS WITH AN IN PLANE MAGNETIC FIELD IN THE PRESENCE OF a STRONG ELECTROMAGNETIC WAVE (LASER RADIATION)

ON THE HALL EFFECT IN PARABOLIC QUANTUM WELLS WITH AN IN PLANE MAGNETIC FIELD IN THE PRESENCE OF a STRONG ELECTROMAGNETIC WAVE (LASER RADIATION)

... electrons in the single (constant) scattering time approximation Then utilizing the similar way as in Ref [14] and performing the analytical calculation for the total current density we have the expression ... values of the HC at the maxima are much larger than other values By using the computational program we easily determine the position of the peak in each curve All the peaks correspond to the ωc2 ... ordinary Hall effect The analytical results are numerically evaluated and plotted for a specific quantum well GaAs/AlGaAs to show clearly the dependence of HC on the external fields and parameters of...

Ngày tải lên: 31/10/2015, 10:41

7 317 0
Lithium-Ion Battery Systems: A Process Flow And Systems Framework Designed For Use In The Development Of A Lifecycle Energy Model

Lithium-Ion Battery Systems: A Process Flow And Systems Framework Designed For Use In The Development Of A Lifecycle Energy Model

... density, all of which are listed in the Figure 10 below The table compiles the data from the available basins in the world and shows the geologic factor pertaining to each The basic brine basin information ... vehicle activity is continuing to decrease the battery charge, and charge sustaining (CS), which retains a relatively constant charge in the battery for each mode of vehicle (Pesaran and Markel, ... Currently in best practices, a 2.5 Li ion can be intercalated for each hexagonal carbon structure reducing the amount of anode in comparison to cathode and can achieve the theoretical capacity of 750...

Ngày tải lên: 10/12/2016, 09:56

107 404 0
báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

... predominantly horizontal and flat direction maintained continuity and shape of the remaining cortical levels Trabecular proliferation was also apparent in a centripetal direction relative to the ... extracellular matrix [5-7] examination of the surgical cavity between the screw holes The samples were prepared in hematoxylin and eosin stain (HE) for histological analysis The objective of the ... including the final version of the manuscript JJCF participated in the analysis of results and implementation of material and other conditions for development of the project All authors approved the...

Ngày tải lên: 11/08/2014, 23:22

9 361 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx

báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx

... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Methods & Applications, vol 10, no 1, pp 55–64, 1986 12 A V Lair and A W Shaker, “Entire solution of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications,...

Ngày tải lên: 21/06/2014, 20:20

16 439 0
Báo cáo hóa học: " Research Article A Two-Stage Approach for Improving the Convergence of Least-Mean-Square Adaptive Decision-Feedback Equalizers in the Presence of Severe " doc

Báo cáo hóa học: " Research Article A Two-Stage Approach for Improving the Convergence of Least-Mean-Square Adaptive Decision-Feedback Equalizers in the Presence of Severe " doc

... estimators such as the RLS algorithm in the cases of modeling errors and incomplete statistical information concerning the input signal, interference, and noise parameters Hassibi [12] examines the ... reference for the interferer during adaptation and is thus forced to converge on the basis of the training data only The feedback taps converge slower than the feedforward taps because the DFE ... complexity of the system; only M +1 of the total 2M + tap weights are adapted In the scenario where there is a phase and/or gain error, the system requires the use of either training symbols to adapt the...

Ngày tải lên: 22/06/2014, 19:20

13 365 0
A study of difficulties in learning english listening skill for beginners in the asemlink of intrernational languages center and some suggested solutions

A study of difficulties in learning english listening skill for beginners in the asemlink of intrernational languages center and some suggested solutions

... questionnaires for learners to get information about the fact of teaching and learning listening skill in the Asemlink center After collecting information, all the data will be analyzed and drawn into the ... information or entertain • Participating in a face-to-face conversation, discussing work as a partner • Watching a film, a play or a TV program to entertain • Participating in a meeting, seminar ... skill in Asemlink center in particular and in Vietnam in general Finally, the author will analyze the results of the survey, interviews as well as the teacher’s observation in teaching in order...

Ngày tải lên: 14/12/2013, 00:41

96 10,6K 53
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... Department of Biotechnology (Govt of India) for partial financial support The authors thank Dinesh Kumar for recording the scanning electron micrographs and Shivcharan Prasad and Pinakin Makwana for ... MPTP alone The apparent rate constant of aggregation in the presence of dopamine was significantly higher (0.25 h)1) than in the presence of MPTP alone (0.096 h)1) This indicates a faster rate of ... an important probe for characterization of the nature of the aggregates Characteristic sigmoidal curves of amyloid-type aggregates, Fig Aggregation of a- synuclein (A) Samples were withdrawn after...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained ... excess of unlabeled methionine/ cysteine Aliquots were removed at the indicated periods and analyzed as described for panel (A) The precursor and mature forms of the PhoE proteins are indicated...

Ngày tải lên: 08/03/2014, 09:20

8 547 0
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

... explore these parameters in detail Second, we plan to appreciably enhance the integrated model It appears from both our initial data analysis, as well as our qualitative examination of the data, that ... We also extend these models to a new task domain that can elaborate on referential patterns in the presence of various forms of shared visual information Finally, we make use of a corpus gathered ... in the visual field as possible referential anchors, and an integrated model that balances the visual information along with the linguistic information to generate a ranked list of possible anchors...

Ngày tải lên: 24/03/2014, 03:20

8 567 0
Báo cáo khoa học: Quenched hydrogen ⁄deuterium exchange NMR characterization of amyloid-b peptide aggregates formed in the presence of Cu2+ or Zn2+ ppt

Báo cáo khoa học: Quenched hydrogen ⁄deuterium exchange NMR characterization of amyloid-b peptide aggregates formed in the presence of Cu2+ or Zn2+ ppt

... distilled water three times and air dried AFM analysis was performed using a Nanoscope IIIa multimode atomic force microscope (Digital Instruments, Santa Barbara, USA) in tapping mode in air A silicon ... [(i) and (ii) ] or EDTA [(v) and (vi)] and continued for 164 After 100 min, 400 lM EDTA was added, and the absorbance was measured for an additional 64 (B) ThT analysis of aggregated Ab samples ... molar excess of divalent metal ions failed to attain the classic morphology of amyloid fibrils [37,46] The aggregates of Ab(1–40) and Ab(1–42) formed in the presence of a chelating agent gave...

Ngày tải lên: 30/03/2014, 01:20

10 294 0
Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf

Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf

... with increasing concentration of TMPTMA up to 15 phr Therefore, in order to obtain PVC having the highest , 0.4 phr of DAPC and phr of TMPTMA can be used in the material Table 2: Linear thermal ... This can be also explained by the presence of TMPTMA as a plasticizer It improves the molecular mobility, melting and softening of PVC and a result, Ts decreases with increasing Table 1: Softening ... crosslinked by DAPC and TMPTMA, the sample containing 0.2 phr of DAPC and 15 phr of TMPTMA has the minimum Ts Used PVC contains a network of crystallites (8.6%), which act as physical crosslinks, and...

Ngày tải lên: 03/04/2014, 15:20

5 377 0
Báo cáo hóa học: "A new low-complexity angular spread estimator in the presence of line-of-sight with angular distribution selection" pptx

Báo cáo hóa học: "A new low-complexity angular spread estimator in the presence of line-of-sight with angular distribution selection" pptx

... distance between the antenna-element i and the antenna-element k; and (b) The V-array: an antenna array (a) Two antenna elements of an antenna array at the base station with antenna elements at the ... The same reasoning is adopted for the ASs estimates (19) One can argue that the mean of the AS estimates could be used instead of the standard deviation in (19) Actually, the mean of the obtained ... (24) The final estimates for the mean AoA and AS is the mean of the obtained estimates associated with the Bousnina et al EURASIP Journal on Advances in Signal Processing 2011, 2011:88 http://asp.eurasipjournals.com/content/2011/1/88...

Ngày tải lên: 20/06/2014, 22:20

16 487 0
Báo cáo hóa học: "Research Article Comparison of Channel Estimation Protocols for Coherent AF Relaying Networks in the Presence of Additive Noise and LO Phase Noise Stefan Berger and Armin Wittneben" pptx

Báo cáo hóa học: "Research Article Comparison of Channel Estimation Protocols for Coherent AF Relaying Networks in the Presence of Additive Noise and LO Phase Noise Stefan Berger and Armin Wittneben" pptx

... remain unchanged for the time it takes all relays to transmit their training sequences to M Afterwards, the phases change and remain unchanged again for the time the master node retransmits to the ... relay gains in a way that the signals from all relays combine coherently at the destinations (e.g., [6]) In any practical network, the gain factors are computed from the estimates hSk Rl and ... this point is a function of the destination index m Increasing the NSD while keeping NR constant is therefore in favor of protocol A1 If the number of relays increases, the relation between l and...

Ngày tải lên: 21/06/2014, 17:20

12 339 0
Báo cáo hóa học: " Research Article New Technique for Improving Performance of LDPC Codes in the Presence of Trapping S" doc

Báo cáo hóa học: " Research Article New Technique for Improving Performance of LDPC Codes in the Presence of Trapping S" doc

... that the dominant trapping sets are formed by a combination of short cycles present in the bipartite graph In the following, we adopt the terminology and notation related to trapping sets as ... runs as a standard BP decoder with the ability to detect and neutralize trapping sets using variable and check nodes configuration information obtained during the learning phase When a trapping ... d(ci ) for message forwarding Fortunately, the communication links needed to forward neutralization messages between check and variable nodes of the trapping sets already exist as part of the BP...

Ngày tải lên: 21/06/2014, 23:20

12 325 0
w