ifnα induces dc maturation but does not alter the expression level of hiv 1 receptors
Báo cáo y học: "Antiviral activity of a-helical stapled peptides designed from the HIV-1 capsid dimerization domain" pps
Ngày tải lên :
13/08/2014, 01:20
... Interestingly, the release of EIAV particles was not impaired by NYAD-2 01 (Figure 7B), indicating Page of 18 that the inhibiting effect of NYAD-2 01 on HIV- 1 particle production was not the result of non-specific ... that 36%, 41% and 38% of SupT1 cells were GFP + at 50 μM, 25 μM or 12 .5 μM NYAD-2 01, respectively, similar to the levels observed (35%) in the absence of NYAD-2 01 In contrast, T-20 at 11 1 nM substantially ... inhibition of the NOTCH transcription factor complex Nature 2009, 462 :18 2 -18 8 63 Arora PS, Ansari AZ: Chemical biology: A Notch above other inhibitors Nature 2009, 462 :17 1 -17 3 Page 17 of 18 64 Wong...
- 18
- 232
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
Ngày tải lên :
18/02/2014, 11:20
... Cytochrome C 4.00 3.75 10 60 11 12 14 15 16 13 Elution volume (mL) 17 18 40 20 10 .0 12 .0 curves at a protein concentration of lm exhibit a signicant deviation from linearity, suggestive of both static ... group of R98 forms a hydrogen bond with the backbone CO of F102 Furthermore, the orientation of the side chain of the two residues brings the guanidinium plane and the aromatic ring of F102 into ... Constructed mutant Primer sequence (5Â- to 3Â) Restriction site W11F W168F WT* Y74W* WT WT W11F WT* W11F W168F W11F W168F W11F W168F Y74W CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt
Ngày tải lên :
18/02/2014, 16:20
... with the square of the charge [20] ( +10 ions react 10 0 times faster than +1 ions), adjustment of the PTR reaction duration allows one to control the charge state of the resulting products For the ... 42 of the proteins disagreed The observed differences could be assigned to: deletion of the N-terminal Met, truncations at either the N-terminus or C-terminus of the protein, and the presence of ... paxillin [10 ] Ions of type c¢ define the first eight amino acids of the peptide as residues 21 28 in the paxillin sequence The next tryptic cleavage site occurs at Arg75, and the predicted mass of this...
- 8
- 578
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
Ngày tải lên :
19/02/2014, 13:20
... Askenase, P.W & Pober, J.S (19 97) Ó FEBS 2004 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Design of peptides for T-cell adhesion inhibition (Eur J Biochem 2 71) 2885 Blockade of CD2–LFA)3 interactions ... (kcalÆmole )1) Number of conformations in the cluster 2 )15 .7 )15 .5 )15 .2 )13 .2 )15 .5 )14 .9 1 Table Amino acid residues forming hydrogen bonds in the cER–CD58 – interface The residues in the turn ... Leu7-Val8-Ala9-Glu10, respectively [ 31] Therefore, the structure of peptide cER consists of two b-turns, located at the N- and C-termini A comparison of the b-turn structure of cER with the similar region in the...
- 14
- 657
- 0
Báo cáo khóa học: Antimicrobial activities of heparin-binding peptides pdf
Ngày tải lên :
07/03/2014, 15:20
... ARKKAAKA 11 .0 11 .0 10 .0 11 .0 12 .0 12 .0 12 .8 12 .8 12 .0 10 .0 10 .5 10 .3 12 .2 9.8 8.7 12 .5 12 .3 12 .0 11 .2 12 .3 12 .0 11 .3 [43] [43] [44] [45,46] [47] [48] [49], this report [49], this report [49] [50] [ 51] ... PGR 11 QPP18 YIG23 SEK20 AKK15 10 40 14 22 40 22 13 38 86 77 71 65 75 93 81 85 92 86 59 80 92 10 1 LRK26 LGE27 0,5 70 40 AKK24 AKK18 AKK12 AKK6 ARK24 ARK16 ARK8 67 62 56 74 55 GHR18 LVT19 KNN15 ... report [15 ,20] [15 ,20] [15 ,20] [15 ,20] [15 ,20] [15 ,20] [15 ,20] GHR18 LVT19 GHRPLDKKREEAPSLRPA (15 –32) LVTSKGDKELRTGKEKVTS( 414 –432) 10 .0 9.5 Negative, this reportb Negative, this report KNN15 KNNQKSEPLIGRKKT (19 46 19 60)...
- 8
- 353
- 0
Báo cáo Y học: Purification, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx
Ngày tải lên :
17/03/2014, 10:20
... components of the samples Peptides a-PEC Crystals of a-PEC Peptide 1A Peptide 1B Peptide 1C Peptide Peptide Molecular mass 18 15 1.6 18 18 15 (15 15 15 1.6 16 7.8 803.2 473.8) 585.0 N-terminus MKTPLTEAIAÆÆAADLRGSYLSÆÆNTELQAVFGRÆÆFNRARAGLEA ... within the different association states of the PEC complexes [11 ,12 , 21] The assembly of ‘monomeric’ and ‘trimeric’ complexes is accompanied by a decrease of the photochemistry from 10 0% of the isolated ... Obviously, the presence of two peaks between 10 and 11 p.p.m which not change and their positions within the spectra suggests that they represent the two tryptophanes, Trp 51 and Trp128, in the peptide...
- 10
- 452
- 1
Báo cáo Y học: Expression and distribution of penaeidin antimicrobial peptides are regulated by haemocyte reactions in microbial challenged shrimp pptx
Ngày tải lên :
18/03/2014, 01:20
... Sci 11 3, 4 61 469 ` 15 Bachere, E., Destoumieux, D & Bulet, P (2000) Penaeidins, antimicrobial peptides of shrimp: a comparison with other effectors of innate immunity Aquaculture 19 1, 71 88 16 ... reactivity observed at the site of injury did not allow investigation of the close interaction between the haemocytes and the microorganisms and the role of penaeidins in these reactions To address ... haemocytes of shrimps that have not been experimentally infected, indicating haemocytes as the main site of production of the peptides [14 ] Here, we show that in shrimp tissues, the distribution of penaeidin...
- 12
- 498
- 0
Báo cáo khoa học: Non-hydrolytic functions of acetylcholinesterase The significance of C-terminal peptides pptx
Ngày tải lên :
23/03/2014, 07:20
... BTX 10 µM 50 ** 80 0 .1 µM µM 10 0 12 0 0 .1 µM µM 10 µM Percentage ACh response 15 0 16 0 µM b a7 10 nM T14 10 µM a Organotypic cultures 200 0 .1 µM C Xenopus oocytes Control nM mM BTX + nM T14 c 10 ... 200 10 0 0 .15 0 .1 0.05 0 T14 T30 [peptide] mM 1/ [ATC] [1/ mM] 20 16 12 Reaction rate Reaction rate C *** * *** * * 10 15 Fractions 20 25 40 30 n.s 20 10 0 10 15 Fractions 20 25 Fig Effects of T14 ... c 10 T3 T1 10 M M M M IV M 10 10 M LA 10 ro C on t M h 10 µM BuChE peptide l 10 µM BuChE peptide M 12 0 s Cultured GH4-h Cells 11 0 10 0 90 80 70 60 50 40 30 20 10 A C 200 nA % Specific [12 5I] BTX...
- 8
- 316
- 0
Báo cáo khoa học: Study of uptake of cell penetrating peptides and their cargoes in permeabilized wheat immature embryos pot
Ngày tải lên :
23/03/2014, 07:20
... 2403–2 414 ª 2008 Her Majesty the Queen in Right of Canada, as represented by the Minister of Agriculture and Agri-Food Canada Journal compilation ª 2008 FEBS 2407 A 0.5 :1 1 :1 2 :1 3 :1 4 :1 5 :1 0.5 :1 ... concentration of the plasmid constant (0.5 : 1, : 1, : 1, : 1, : 1, : 1, w ⁄ w) A gel retardation assay showed that the mobility shift began at a : ratio of the Tat2 and GUS enzyme The fluorescence ... retardation assay The purified supercoiled plasmid DNA (1 lg of pAct1GUS, 7.2 kb) was mixed with different concentrations of Tat2 to give ratios of 0.5 : 1, : 1, : 1, : 1, : and : of Tat2 and plasmid...
- 12
- 467
- 0
Báo cáo khoa học: Zinc potentiates the antibacterial effects of histidine-rich peptides against Enterococcus faecalis pot
Ngày tải lên :
23/03/2014, 11:20
... 0 37.4 47 .1 ATCC 25922 27 .1 1 515 9 ATCC 27853 0 8.3 ± 7.5 34.2 ± 8 .1 0 0 1. 1 ± 1. 7 20.7 ± 6 .1 rich domain binds heparin independent of Zn2+ [20] As shown previously, a peptide from the latter ... lM Zn2+ 10 0 lM Zn2+ 2374 BD 33 ⁄ 03 ATCC 29 212 80 BD 312 ATCC 29 213 59.6 ± 6.7 28.5 ± 3.8 78 .1 ± 10 .6 0 69.3 ± 10 .0 28.9 ± 6.3 63.3 ± 9.9 0 64.6 ± 6.4 12 .1 ± 2.7 56.0 ± 5.6 0 45.2 ± 14 .3 9.4 ... interesting to note that the total concentration of Zn2+ in plasma is 10 18 lm, but thrombocytes can accumulate levels of Zn2+ that are 25–60-fold higher than those found in plasma [29] Furthermore,...
- 8
- 250
- 0
Báo cáo khoa học: Multifunctional host defense peptides: functional and mechanistic insights from NMR structures of potent antimicrobial peptides docx
Ngày tải lên :
29/03/2014, 22:21
... Dis 62, 17 – 21 12 Durr UH, Sudheendra US & Ramamoorthy A (2006) ¨ LL-37, the only human member of the cathelicidin family of antimicrobial peptides Biochim Biophys Acta 17 58, 14 08 14 25 13 Epand ... immune system, forming the first line of defense against invading microbes They are also implicated in the stimulation and modulation of adaptive immunities [11 ,12 ] On the basis of their structures, ... hand, the presence of cholesterol reduced the tilt of the MSI-594 helix to within 5° and that of the MSI-78 peptide to < 5° This observation on the reduction in the tilt angle could be attributed...
- 9
- 277
- 0
Báo cáo khoa học: Effect of the -Gly-3(S)-hydroxyprolyl-4(R)-hydroxyprolyltripeptide unit on the stability of collagen model peptides ppt
Ngày tải lên :
30/03/2014, 02:20
... Tm (°C)a )3 21 )224 )17 7 )17 0 )15 8 )15 6 )8 81 )5 81 )439 ) 418 )373 )370 52.0 52.8 51. 0 52.6 56.2 55.3 a Tm (°C) ΔS (J·K 1 mole 1 trimer) Temperature (°C) modification lowered the Tm of the peptide ... rate of 0.5 °CÆmin )1 between the amide group of Gly and the carbonyl group of 3(S)Hyp might be weaker than the hydrogen bond between the amide group of Gly and the carbonyl group of Pro They ... the excess heat capacity of the peptides as a function of temperature Replacement of Pro by 3(S)Hyp decreases the transition enthalpy The first replacement of Pro by 3(S)Hyp in the middle of the...
- 11
- 601
- 0
Báo cáo khoa học: Grafting of thrombopoietin-mimetic peptides into cystine knot miniproteins yields high-affinity thrombopoietin antagonists and agonists pot
Ngày tải lên :
30/03/2014, 10:20
... was replaced with the linear peptide (AF12505) or the disulfide bond-constrained peptide (AF1 219 3), respectively (Table 1) In a second set of constructs, the inhibitor loop of the Ecballium elaterium ... supplemented with equal amounts of the miniproteins or control peptides and grown in the presence or absence of rhuTPO Whereas neither the control peptides AF1 219 3 and AF12505 nor the miniprotein constructs ... High-resolution NMR structure of the chemically-synthesized melanocortin receptor binding domain AGRP(87 13 2) of the agouti-related protein Biochemistry 40, 15 520 15 527 11 Jackson PJ, McNulty JC,...
- 10
- 262
- 0
Báo cáo khoa học: Bilayer localization of membrane-active peptides studied in biomimetic vesicles by visible and fluorescence spectroscopies pptx
Ngày tải lên :
30/03/2014, 20:20
... modification of the rigidity of the lipid environment in proximity to the fluorescent probe; and alteration of the amount and mobility of water molecules at the probe area [30,35,38] The effects of the ... Ole2PtdSer/PamOlePtdCho/PDA vesicles (Fig 3B), confirm that the presence of the conjugated polymer does not affect the SR properties of Patman These results also indicate that the phospholipid moieties retain their ... PamOlePtdCho/PDA Ole2PtdSer/PamOlePtdCho/ PDA Peptide added sr (ns)a SR (%)b Dm (cm )1) c None KAL Melittin Magainin II None KAL Melittin Magainin II 1. 3 1. 4 1. 7 1. 6 0.9 1. 2 1. 8 2.4 97 91 95 94 71 85...
- 10
- 479
- 0
Báo cáo khoa học: Identification of proNeuropeptide FFA peptides processed in neuronal and non-neuronal cells and in nervous tissue potx
Ngày tải lên :
31/03/2014, 07:20
... 13 66.7 10 80.6 19 77.0 13 35.7 13 48.7 32.8 28.5 264.4 29.9 15 00.2 ± ± ± ± ± HPLC -1 1.3 1. 3 29.5 3.2 14 9.3 HPLC-2 HPLC-3 Observed [M + 2H]2+ (m/z) – 33.7 – 36.78 36 .12 41. 85 42.79 44.42 – – 54. 91 ... 5 41. 3 from 10 0 fmol of synthetic NPFF (A), at m/z 684.5 from 10 0 fmol of synthetic SQA-NPFF (D), at m/z 5 41. 3 (B) and m/z 684.5 (E) in HPLC fraction of COS-7 cell extract MS/MS spectra of the ... the sample The coelution of SPA-NPFF and QFW-NPSF did not allow the quantification of each peptide in the HPLC fractions Considering the poor affinity of QFW-NPSF for the antibody used (Table 1) ,...
- 13
- 277
- 0
mass spectrometry of proteins and peptides
Ngày tải lên :
11/04/2014, 09:50
... (Daltons) 10 ,307.6 11 ,332.7 20, 614 .1 26 ,16 6.6 36,456 .1 37,4 81. 2 10 ,308 11 ,333 20, 615 a 26 ,16 9b 36,459b 37,484 aA small peak at 21, 640 Daltons was also observed, which was attributed to the rCP10-mutant ... 15 –33 1 14 34–59 64–85 614 .6 /16 39.7 2287.5 14 57.7 315 7.7 2432.8 Not isolated /16 39 2288/2288 14 57 /14 57 315 8/ 315 8 2433/2433 Fig Comparison of the C18 RP-HPLC chromatograms of the Asp-N digestion of ... 3 .1. , step 2) The mutant form eluted at 13 .6 as a distinct peak followed by rCP10 at 14 .1 (Fig 2A) The disulphide-linked homodimer of rCP10 eluted at 15 .1 followed by GST at 17 .5 (Fig 2A) The...
- 515
- 329
- 0
Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot
Ngày tải lên :
20/06/2014, 20:20
... evaluated the correlation between the number of emitted photons and the amount of FITC by measuring the FITC volume using AFM Finally, we estimated the quantity of Aβ peptides of the cells placed on the ... follows: # of emitted photons , (3) Φ≡ # of absorbed photons the number of emitted photons indicates the multiplication of the quantum yield and the number of photons absorbed within the fluorochrome ... drafted the manuscript H-RS carried out the preparation of cells and the treatment of antibody and fluorescence K-BS conceived the basic idea of the whole experiment and supported the mathematical...
- 12
- 690
- 0
Overview of User Interface Design docx
Ngày tải lên :
28/06/2014, 07:20
... user cannot figure out how to it or doesn’t like the system, the system is not easy to use • This is another kind of usability problem – We classify them according to their severity to the user, ... Importance of usability • Who is responsible for the usability of the final system? – Programmers and other developers take responsibility for the technical correctness of the system and for the necessary ... interfaces are not user interfaces since the user doesn’t interact directly across them – The user interacts indirectly with them through the user interface to the computer Design of user interfaces...
- 65
- 584
- 0
Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx
Ngày tải lên :
11/08/2014, 03:20
... SRL: specific lung resistance; SMR1: submandibular rat -1; VCS -1: variable coding sequence -1; VPSP: ventricular peak systolic pressure Page 10 of 11 10 11 12 13 14 15 Competing interests DAG is a ... anti-endotoxin activities [16 ,17 ] SGP-T was identified as the carboxyl terminal of SMR1, a 14 6amino acid, multipotent prohormone product of the VCSa1 (variable coding sequence A1) gene [18 ], which is also ... of the immunomodulating tripeptide feG-COOH in experimental feline asthma Vet Immunol Immunopathol 2009, 13 2 :17 5 -18 0 Page 11 of 11 54 John SM, Bao F, Chen Y, Mathison RD, Weaver LC: Effects of...
- 11
- 406
- 0