if a set can be expressed as the disjoint

... The last zone accommodates a parity * This number is roughly equal to the number of members of the Mathematical Association of America (MAA), the largest professional organization for mathematicians ... using the Hawaiian alphabet if the second and last letters are vowels and the other are consonants? (d) How many four-letter ‘‘words’’ can be produced from the Hawaiian alphabet if the second and ... this that the chapter derives its name To the uninitiated, mathematics may appear to be ‘‘just so many numbers and formulas.’’ In fact, the numbers and formulas should be regarded as shorthand notes,...

Ngày tải lên: 31/03/2014, 15:57

... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains ... plasmid pBDC [34] (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, ... of human cytosolic Hsp90 can therefore activate human ERK5 MAP kinase in yeast Rlm1p, the major trans-activator of cell wall genes in yeast, is activated through Slt2p-catalyzed phosphorylation...

Ngày tải lên: 23/03/2014, 07:20

... price and the normal value in the EU's law is the same as the WTO's It must be fair, specific, shall be made at the same level of trade and in respect of sales made at as nearly as possible the same ... nation income per capita, Brazil is classified in the same category as China, Thailand and Indonesia, not Vietnam Vietnam has to import cow leather and does not have the same access to raw materials ... comparable export transactions - A comparison of normal value and export prices on a transaction-to-transaction basis - a weighted average basis may be compared to prices of individual export transactions...

Ngày tải lên: 04/04/2013, 16:17

... EU anti-dumping laws Making comparison between the export price and the normal value in the EU's law is the same as the WTO's It must be fair, specific, shall be made at the same level of trade ... because of association or a compensatory arrangement between the exporter and the importer or a third party In these cases, the second method will be used The normal value "The normal value is the ... non-market economy country Albania, Armenia, which is a member of the WTO at the Azerbaijan, Georgia, date of the initiation of the investigation Kyrgyzstan, Moldova and Mongolia Other non-market...

Ngày tải lên: 27/07/2013, 08:50

... S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 (Figs and 3) All shared a codon usage and a G+C content at ... complementation assays The ataP5, ataP4 and ataP10 genes were also independently inserted in the pIJ702 vector and the resulting plasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively (Materials and methods), ... The ata genes and their deduced proteins Cosmid pABC6.5, which overlaps cosmids pCAR11 and pCAR13, was isolated as indicated under Materials and methods These latter cosmids contain the A2 01A...

Ngày tải lên: 21/02/2014, 01:21

... mutagenic forward primers were used: Y28 6A, 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â ... both the apical and basolateral compartments of the culture dishes The MDCK cell monolayer provides a barrier between the apical and basolateral compartments The voltage drop over the membrane was ... sorting signals, transmembrane sorting signals have been identied For example, the gastric H,K-ATPase has an apical sorting signal in its 4th transmembrane domain, although the exact amino acids responsible...

Ngày tải lên: 23/03/2014, 04:20

... Learning a language can transform us as individuals – it can change our worldview and even our personality DEFINITION Language Worldview Personality Learning a foreign language Learning a foreign ... foreign language helps you understand your mother tongue and culture The American lifestyle is open than the Vietnamese lifestyle American Family Vietnamese Family THE NEW OPPORTUNITIES Understanding ... communicate with other people  Being affected various lifestyle - Being much better equipped to adapt a fastchanging world -Learning to effectively handle new situations THE END Thank you for...

Ngày tải lên: 31/05/2014, 13:04

... exclude undiagnosed diabetes mellitus Case presentation A 24-year-old southeast Asian woman was admitted with a history of a white spot on the right cornea and increasing discomfort On examination, ... careful assessment of corneal sensation Dry eye disease can also delay healing and can be identified with rose-bengal staining of the cornea and conjunctiva and use of the Schirmer test Nocturnal lagophthalmos ... of undiagnosed diabetes mellitus Case presentation: We report the unusual case of a 24-year-old southeast Asian woman who presented with a sterile corneal ulcer to our hospital and later was found...

Ngày tải lên: 10/08/2014, 22:20

... 120 90 90 60 60 30 30 0 LAI LAI-lhNef AS4 4 AS1 5 HIV HIV-lhNef AS4 4 AS1 9 AS1 5AS1 9 AS1 1 HIV HIV- AS4 4 AS1 9 AS1 5 AS1 1 lhNef AS1 1 AS6 AS6 AS6 R1 B trans-inhibition of HIV-1 CA-p24/RL (%) 360 360 300 ... hairpin-containing AS variants In fact, all AS mutants outcompeted wild-type HIV-1, as illustrated for the AS1 9 variant (Fig 6A) The results for all AS variants are summarized in Table and shown in Additional ... production was measured in the culture supernatant days after transfection by CA-p24 ELISA and Renilla expression was measured with the Renilla luciferase assay system (Promega) We plotted the relative...

Ngày tải lên: 13/08/2014, 09:20

... kh a điện 14 Đèn báo ch a kh a không nằm ổ 15 Đèn cảnh báo kh a bấm điều khiển từ xa hết pin 16 Đèn cảnh báo khoảng cách 17 Đèn báo nhấn chân côn 18 Đèn báo nhấn chân phanh 19 Đèn báo kh a vô-lăng ... Đèn sương mù (sau) Đèn cảnh báo nước r a kính mức thấp Đèn cảnh báo má phanh Đèn báo bật hệ thống điều khiển hành trình Đèn báo rẽ Đèn báo cảm ứng m a ánh sáng Đèn báo chế độ lái m a đông 10 Đèn ... Đèn báo làm tan băng kính chắn gió 59 Đèn báo cốp xe mở 60 Đèn báo tắt hệ thống cân điện tử 61 Đèn báo cảm ứng m a 62 Đèn cảnh báo động cơ/khí thải 63 Đèn báo làm tan băng c a sổ sau 64 Đèn báo...

Ngày tải lên: 15/03/2015, 21:24

... least far/farther(further) /the farthest (the furthest) Double comparison(So sánh kép) + Same adj: Short adj:S + V + adj + er + and + adj + er Long adj:S + V + more and more + adj Vd: The weather ... as tall as that one (Không lặp lại từ dùng chủ ngữ) Population ofHo Chi Minh city isn't as much as thatof Bangkok Comparative(So sánh hơn) Short Adj:S + V + adj + er + than + N/pronoun Long Adj: ... make a decision, make love… To have dinner, have a party, have a holiday… To some work, a job, homework,… III Cách sử dụng in on at thời gian At: mốc thời gian cụ thể Vd: At 6:00am, at noon, at...

Ngày tải lên: 15/03/2015, 21:25

... vùng Kasa, Atxam Manipua cắt hai tỉnh giàu có Arakan Tenatxerim cho Anh bồi thường triệu bảng Anh” [29, tr 217] Đến kỷ XIX chiến tranh Anh – Miến lần thứ hai bắt đầu (1852 – 1854) Sau hai chiến, ... Taguchi Ukichi, Suganuma Tadakaze, Inagaki Manjiro Takekoshi Yosaburo Shiga Shigetaka với “Nam Dương thời sự” phát hành năm 1887, ghi chép ông chuyến đến vùng biển Nam Thái Bình Dương Australia ... Canada” [Dẫn theo 7, tr.17] Trong Luận văn sử dụng khái niệm Đông Nam Á bao gồm 11 quốc gia: Philippines, Indonesia, Đông Timor, Brunei, Malaysia, Singapore, Việt Nam, Lào, Campuchia, Thái Lan...

Ngày tải lên: 02/12/2015, 08:56

Ngày tải lên: 08/08/2012, 17:20

... modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the ... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... will actually happen or is actually true at this moment (76) could 26 be then paraphrased as Perhaps they are/ will be poor; and (77) as Perhaps you are no better than the rest; you have intolerable...

Ngày tải lên: 29/01/2014, 00:23

... this article as: Papalambros et al.: GIST suture-line recurrence at a gastrojejunal anastomosis years after gastrectomy: can GIST ever be described as truly benign? A case report World Journal ... hepatic metastasis and as the patient’s performance status was otherwise excellent, the decision for a second operation was deemed favorable The patient went on to have a successful completion gastrectomy ... [6,7,10] The American Joint Committee on Cancer (AJCC) has created a similar scheme but also incorporate advanced and metastatic GISTs [13] The latest risk scheme has recently been published in the...

Ngày tải lên: 09/08/2014, 03:22

... suprasternal area in order to avoid the low-lying permanent tracheostomy A right subclavicular incision was also made and the right axillary artery was exposed Cardiopulmonary bypass (CPB) was ... custodial cardioplegia as a single dose of 2025 ml per kg, and guarantees h of myocardial ischaemia In exceptional cases of myocardial ischaemia larger than h, a half dose of cardioplegia can be ... temperature of 25°C Upon cardiac fibrillation, a crossclamp was placed across the ascending aorta and resected above the coronary ostia in the sinotubular junction Myocardial arrest was achieved...

Ngày tải lên: 10/08/2014, 09:21

... during a review of the radiograph, the double bubble sign was appreciated and duodenal obstruction was suspected At surgery, an annular pancreas was detected and the foreign body was found to be ... C, Rangarajan M, Rajapandian S, Vittal SK, Maheshkumaar GS: Laparoscopic retrieval of 'stubborn' foreign bodies in the foregut: a case report and literature survey Surg Laparosc Endosc Percutan ... considered abnormal An abdominal CT scan is of great help in diagnosing and detecting the etiology of intestinal obstruction in 73–95% of cases [1012] A CT scan may also be able to demonstrate the foreign...

Ngày tải lên: 11/08/2014, 21:22

... to the diagnostic arsenal against microbes, contagious and parasitic diseases, because it is easy to use, is economical, requires small antigen dosage, and the results are easy to interpret Therefore, ... the arteriae carotis and stored at -80°C until use Purification of the antisera The rabbit IgG fraction was precipitated from the harvested rabbit polyclonal antisera in saturated ammonium Page ... (O1), SE, RA, and P multocida, and the livers from the dead ducks were obtained as the antigen species, while normal saline was used as the negative control in parallel ? Sample preparation Aseptic...

Ngày tải lên: 12/08/2014, 04:20

... bronchoalveolar lavage and EB as part of their clinical assessment in order to help confirm the diagnosis of asthma and to exclude any other associated abnormalities such as structural airway abnormalities ... sub-segmental airways A separate score was given to each lobe Scores ranged from to was normal wall thickness, was minimal wall thickening, was bronchial wall thickness half of the diameter of the adjacent ... Kasahara K, Shiba K, Ozawa T, Okuda K, Adachi M: Correlation between the bronchial subepithelial layer and whole airway wall thickness in patients with asthma Thorax 2002, 57:242-246 Little SA,...

Ngày tải lên: 12/08/2014, 16:20

... exponential term of the pharmacokinetic model The lower the AIC value, the better the fit between observed data and the plasma glucose decay curve Approximated IDVG was calculated from the increase ... injection.) Data are expressed as mean ± standard deviation (SD) Bland–Altman plots were used to compare the bias (the mean of the differences) and precision (SD of bias) between measurements In addition, ... calculated approximated IDVG from the increase in plasma values above baseline at after glucose injection determined using the reference glucose analyzer Each approximated IDVG was calculated according...

Ngày tải lên: 12/08/2014, 20:21