identify the stated main idea of a paragraph or passage

The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... view the log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data ... area is reserved for this purpose. The separate data area of these database systems means that they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space ... home of the data. Rather than redoing the operation to the separate data copy, Sprite LFS recovery insures that the indexes point at the newest copy of the data in the log. Collecting data in the...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
Finding the Implied Main Idea

Finding the Implied Main Idea

... 2, a main idea is defined as an assertion about the subject that controls or holds together all the ideas in the passage. There- fore, the main idea must be general enough to encompass all the ideas ... the following fictional paragraph describes a character. Read it carefully, make your observations, and then identify the main idea of the paragraph: Every morning when Clara arrives at the gym, she ... main idea. Answer a, “Clara is shy,” cannot be the correct answer either, since everything in the paragraph sug- gests that Clara is, in fact, quite outgoing. Furthermore, the language of the paragraph...

Ngày tải lên: 25/10/2013, 17:20

12 674 0
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

... exophoric anaphoric anaphoric anaphoric exophoric anaphoric exophoric anaphoric anaphoric anaphoric anaphoric exophoric anaphoric anaphoric anaphoric anaphoric exophoric anaphoric ... 21. they 13. man 23. the man 26. the man 26. the man anaphoric exophoric cataphoric anaphoric anaphoric anaphoric cataphoric anaphoric anaphoric exophoric exophoric anaphoric ... Behaver Senser Carrier Senser Actor Carrier Actor Actor Carrier Sayer Senser Actor Actor Actor Sayer Goal Actor Sayer Actor behavioural breathed mental looked at relational...

Ngày tải lên: 12/02/2014, 20:20

18 714 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... CTGAGGTTACAGACAACTGTTC 13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 ... GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi et al. A novel isomerohydrolase in the retina FEBS Journal 278 (2011)...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 min when assayed at 35 °C (Fig. 3A, B). The presence of Ca 2+ increased the thermal stability of PhyH and ... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a ... therefore enhance the catalytic efficiencies of single-domain phytases. Thus, PhyH-DI fused to another single-domain phy- tase may improve the catalytic efficiency of the latter. Materials and methods Strains,...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

... operation of a safe passage route or modify the passage arrangements while ensuring that one of the routes remained open for safe passage. 126 As under the Cairo Agreement, safe passage permits or ... Peninsula Gulf of Oman U .A. E. Russian Federation Muskat Angola Luanda Congo Cabinda Argentina Chile Rio Grande Atlantic Ocean Pacific Ocean Estonia Latvia Lithuania Belarus Poland Riga Kaliningrad ... Many states are comprised of a mainland and islands, such as Australia, which consists of the mainland and islands including Tasmania, Norfolk, and very distant islands like Christmas and...

Ngày tải lên: 16/02/2014, 11:20

64 307 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... centres of the donor and acceptor, and that the reduction potentials ensure a favourable driving force, which is one of the main determinants of the rate of electron transfer [4]. Experimental measure- ments ... parameter optimization. The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points ... the thermodynamic model to the NMR data (for the case of DvHc 3 :ZnRb), or to the NMR and UV-visible data sets simultaneously (for the case of DvHc 3 :Pi) using the Marquardt method for parameter optimization....

Ngày tải lên: 19/02/2014, 17:20

10 640 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

... OOPSLA ’97, (Atlanta, GA), ACM, October 1997. [3] G. Parulkar, D. C. Schmidt, E. Kraemer, J. Turner, and A. Kantawala, “An Architecture for Monitoring, Visualization, and Control and Gigabit Networks,” ... events have ar- rived from a particular set of suppliers, e.g., a correlation of events. For instance, an I/O Facade may depend on data from a sub- set of all Sensor Proxies. Furthermore, it may use ... mission control applications would require I/O Facades that actively acquire data from the Sensor Proxies. If data was not avail- able to be pulled, the calling I/O Facade would need to block awaiting a result....

Ngày tải lên: 19/02/2014, 18:20

20 738 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... 44–50. 4.Sakiyama,F.&Masaki,T.(1994)Lysylendopeptidaseof Achromobacter lyticus. Methods Enzymol. 244, 126–137. 5. Ohara, T., Makino, K., Shinagawa, H., Nakata, A. , Norioka, S. & Sakiyama, F. ... deviation, the solvent ASA of the side-chain of His210 increased with the decrease in size of the side-chain at residue 169 (Table 1 and Fig. 3A) . However, the ASAs of Asp113 and His57 remained constant ... is supported by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad. ACKNOWLEDGEMENT We are...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

... CONE 1251 of N. Buchdahl [Buc99, 00] and A. Lamari [Lam9 9a, 99b]; it turns out that there exists a very neat characterization of nef classes on arbitrary surfaces, Kăahler or not. The Main Theorem has ... DEMAILLY AND MIHAI PAUN The proof is based on a mass concentration technique for Monge-Amp`ere equations, using the Aubin-Calabi-Yau theorem. We first start with an easy lemma, which was (more or ... δ  [Y  ] for some δ  > 0. Annals of Mathematics Numerical characterization of the Kăahler cone of a compact Kăahler manifold By Jean-Pierre Demailly and Mihai Paun NUMERICAL CHARACTERIZATION...

Ngày tải lên: 05/03/2014, 23:20

29 468 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... Ile-Glu-Ala-Arg-p-nitro- anilide (IEARpNA) [31]. ProHP8 Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase activity increased significantly above that of factor Xa alone, which could also ... trun- cated form of proHP8 Xa and the catalytic domain of active HP8 are marked with arrowheads. The size and position of molecular weight stan- dards are indicated on the left. (B) The catalytic activity ... hemocyte cDNA or 1 : 25 for fat body cDNA) was used as template for quantitative RT-PCR analysis. The M. sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

... unobservable actions in white. Another view of an attacker model is that the insider has certain attributes that are perhaps measurable. Attacks have certain observables, and the type of outcome can ... services and facilities, were Erik G. Met- tala and David Sames (McAfee Research). The organizers of the workshop also greatly appreciate the time and attention of senior members of the intelligence ... from the larger workshop that the attacks look technical, this group responded, “They’re [the attacks are] actually brain-dead!” The group emphasized that although the attacks may look sophisticated...

Ngày tải lên: 06/03/2014, 16:20

137 344 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

... Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the residue altered to Ala was tested for its activity on a- pNPG. None of the mutants including D21 5A had activity ... a- glucosidase MalL (sucras e-isomaltase-maltase) of Bacillus subtilis. J. Bacteriol. 180, 2 574–2578. 35. Nakao, M., N akayama, T., Kakudo, A. , Inohara, M., Harada, M., O mura, F. & Shibano, ... possible catalytic residues of Taka-amylase A. J. Bi ochem. 95, 697 –702. 4. Nakajima, R., Imanaka, T. & Aiba, S. (1986) Comparison of amino acid s equenc es of eleven d ifferent a- amylases. Appl. Microbiol....

Ngày tải lên: 07/03/2014, 16:20

7 452 0
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

... profiles (A) and a summary of the analysis results (B) for the artificial example system. The small circle points on each temporal profile of m i indicate that we can find the corresponding information ... however, only applicable to the case when for each node there are as many parameters as the number of overall network nodes and these parameters do not directly affect the corresponding node. The fundamental ... excluding the INS at x i obtained at Step 3 from the ANS at x i and thereby we can identify the true interaction structure at x i (Supplementary material, Supplementary mathematical descriptions, Theorem...

Ngày tải lên: 07/03/2014, 21:20

10 375 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... conformations of the b-amino acids backbone, corresponding to gauche rotamers around the Ca–Cb bond, can overlap canonical backbone conformers observed for a- amino acids. Therefore the addition of ... expressed as K i for NK-1M (major site) and NK-1m (minor site), and EC 50 values for the cAMP pathway and for the inositol phosphates pathway. SP, [Ala9]SP and [Pro9]SP are almost equipotent at the major ... potential energy surfaces the conformers of b-amino acids that fit with canonical conformations of a- amino acids, two (/ ) w) Ramachandran maps corresponding to h torsion angle values of +60°,gauche(+) ,or) 60°,...

Ngày tải lên: 08/03/2014, 08:20

11 861 0
w