identify opportunities for the reuse of architectural elements chapter 9

... conventions that the parties undertake to adhere to and effectively implement, such as the agreement for the implementation of the provisions of the UN Convention on the Law of the Sea relating to the conservation ... eradication of poverty and the protection of human rights, in particular the rights of the child, as well as to the strict observance and the development of international law, including respect for the ... of the two overarching themes of the conference, and the outcome document of Rio+20, The Future We Want, dedicates a section to it Although the provisions of the document li le to clarify the...

Ngày tải lên: 29/08/2016, 08:13

... fluctuations of the matrix elements for the desymmetrized quantum cat map We present a conjecture for the distribution of the normalized matrix elements, namely that their distribution is that of a certain ... , ψi = tr D(m)D(n)∗ + O(N −1 ) i=1 The proof of the second assertion is similar  497 MATRIX ELEMENTS FOR QUANTUM CAT MAPS Proof of Theorem In order to prove Theorem it suffices, by Proposition 6, ... d Then I is an O-ideal, and the matrix of α acting on I by multiplication in the basis v1 , v2 is precisely A The choice of basis of I gives an identification I ∼ Z2 = and the action of O on the...

Ngày tải lên: 29/03/2014, 07:20

... Tuberculosis Unit of the Novartis Institute for Tropical Diseases (NITD) I would also like to thank them for their full support throughout the duration of the course I thank all the members of the Tuberculosis ... Zumla, 199 9; Manganelli et al., 2004; Espinal et al., 2001; Raviglione et al., 199 7) The WHO estimates that 90 % of the tuberculosis cases occur in the developing world (50% of those in the sub-Saharan ... cavity) where the bacilli multiply exponentially following exposure to high oxygen levels (Canetti, 195 5; Enarson and Rouillon, 199 4) The softening of the caseum into the large airways of the lungs...

Ngày tải lên: 15/09/2015, 22:51

... on the prevalence in the population, and more reflective of the test itself, lessening the impact of any unique features of the VA population Moreover, we might expect that the PPV and NPV of the ... Algorithm* Yes 60 19 79( 26%) No 23 203 226 (74%) Total 83(27%) Sn = 72% 222 (73%) Sp = 91 % 305(100%) PPV = 76%, 95 % CI71, 81% NPV = 90 %, 95 % CI88, 92 % 95 % CI 67, 95 % CI 89, 77% 93 % CI: Confidence ... performed in SAS 9. 2 (SAS Institute, Cary NC) Results The characteristics of the VARA participants measured at the start of each treatment episode were evaluated Because the characteristics of...

Ngày tải lên: 25/10/2012, 10:45

... attempted for three SPT patients in whom the mass was located in the portion of body or tail of the pancreas For tumors of SPT located in the neck and body of the pancreas, resection of the midportion ... midportion of the pancreas and the mass with preserving the rim of the head and tail portion can be achieved However, for the patient in whom the mass was located within the head of the pancreas, ... conflict of interest exists 312 References 10 11 12 13 14 15 16 17 18 19 20 Crawford BE2nd Solid and papillary epithelial neoplasm of the pancreas, diagnosis by cytology South Med J 199 8 ;91 :97 3 -93 7...

Ngày tải lên: 25/10/2012, 11:40

... 100% relief of their pain in 86% of the patients with a median relief period of months The range of relief varied from zero days to up to 13 months for the facet injection group None of the lumbar ... median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of the 14 patients ... that the direct visualization of the joint allows better de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and capsular tissue Limitations of the...

Ngày tải lên: 26/10/2012, 09:32

... laminoforaminoplasty, should decrease the risk of major adverse events, allow for same day hospital discharge, and decrease the need for postoperative analgesia and immobility [5] [6] In the current ... compression Spine 199 1; 16: 1312-1320 Porter RW, Hibbert C, Evans C The natural history of root entrapment syndrome Spine 198 4; 9: 418-421 Vanderlinden RG Subarticular entrapment of the dorsal root ... a cause of sciatic pain Spine 198 4; 9: 19- 22 Gala VC, O'Toole JE, Voyadzis JM, et al Posterior minimally invasive approaches for the cervical spine Orthop Clin North Am 2007; 38: 3 39- 49 Fessler...

Ngày tải lên: 26/10/2012, 09:57

... system, in the distal segment of the tubule Inhibition of glucose reabsorption in the kidney, mediated by the SGLT cotransport system, represents a promising therapeutic target for the control of hyperglycemia ... larvae of beetles (Chrysomelidae) Their synthesis has been previously described [31-33] For the purpose of the present study the thioglycosides used were selected and grouped based on their differences ... IC50 values of 30 µM for hSGLT1 and 10 µM for hSGLT2, while thioglycoside VII showed IC50 values of 15 µM for hSGLT1 and 88 µM for hSGLT2 These data confirm the strong inhibitory effects of thioglycoside...

Ngày tải lên: 26/10/2012, 10:04

... 0. 796 0 .91 0 0.832 0.8 89 0.848 0.881 0.8 19 0.8 09 0.784 0.8 19 0.761 0.845 0.821 0.817 0.782 0.826 0.758 0.848 0.7 89 0 .92 6 0 .95 7 0 .97 1 0 .91 4 0 .95 7 0 .90 5 0 .92 2 0 .93 4 0 .93 8 0 .91 3 0 .95 2 1.000 0 .96 1 ... 0.873 0. 894 0 .90 2 0 .90 2 0.860 0.825 0.868 0.846 0.8 49 0.853 0.865 0.821 0.838 0.847 0.841 0.814 0.860 0 .90 3 0 .94 6 0 .96 1 0 .90 0 0 .92 0 0 .90 8 0 .92 0 0. 896 0 .95 3 0. 899 0 .94 7 0 .98 9 0 .94 4 0.806 0.552 0.826 ... 0.4 59 0.325 0 .92 3 0 .98 1 1.000 0 .98 1 5.4 19 7 .98 1 6.600 7.778 206 78 100 26 351 47 28 75 367 120 28 148 74 15 20 35 6 0 .91 2 0 .97 3 0 .94 8 0.8 89 0 .92 4 0 .90 8 0.885 0 .94 2 0.843 0 .90 9 0.887 1.000 0 .92 6...

Ngày tải lên: 03/11/2012, 10:58

... prices and the GNP per head were estimated by BMI are showed in table 2.1: Table 2.1: Vietnamese market size/GDP per head 199 3 199 4 Market size (US$ bn) 17.3 199 6 199 7(f) 24.5 19. 9 199 5 26.6 29. 6 344 ... supermarkets, while the heavy ones go there mainly for buying everyday necessities, for what the core business of the stores offer 4.2 From the supermarket side The booming economy during 199 0s brought ... most of the heavy users go to supermarkets buy necessities, there are merely 15% of non-users go there for everyday needs Contrariwise, three-quarter of the non-users went there because of the...

Ngày tải lên: 13/04/2013, 10:30

... Step 3: The director of the branch will responsible for approving the loan application form or not if the value of the loan does not exceed 500 million In case of an exceed, the director of the branch ... Incomes of credit loans Reasonable expenditures Profits before tax 16 18 22 12.5 22.2 9. 088 33.378 91 .95 0 24. 290 267,3 58.572 175,5 3.7 89 15.872 45. 197 12.083 318 ,9 29. 325 184,8 5. 299 17.506 ... not carry out the contract, the collateral is under the decision of the bank 2.3 The history emergence of consumer loans The crisis in the banking system started in the 197 0s, when the brokers...

Ngày tải lên: 25/07/2013, 11:20

... exposed to them (Sugimura 198 6) We have chosen two other sensitive strains (Suzuki et al 199 7, Yamada et al 199 5) in order to assess the mutagenicity of 255 chemicals YG3003 was used to aid the identification ... activity than their host strains TA98 and TA100 (Hagiwara et al 199 3) We compared the mutagenic activity (shown as the number of revertants per nanomolecule of chemicals, rev./nmol) of YG strains ... 47,000 33,600 26,600 17,500 16,100 15,700 12,600 9, 720 9, 230 9, 080 6 ,91 0 6 ,91 0 6,180 4,280 4,250 3 ,91 0 10 11 12 13 14 15 16 17 18 19 20 YG1042, -S9mix Chemicals Mutagenicity (rev./nmol) 1,8-Dinitropyrene...

Ngày tải lên: 05/09/2013, 08:40

... study, the ozone and UV combination (ozone/UV) process is applied for the reuse of sewage effluent Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process for the treatment ... coli in the sewage effluent The concentration of E coli was 98 0~1050 CFU/mL As shown in Figure 5, 3.6 mg/L of ozone dose and 0.83 W-min/L of UV dose were required for the 99 % inactivation of E coli ... reduction of A410 after 10 of run time On the other hand, the UV alone process did not show much color change Therefore, for color reduction, the ozone alone process was considered as the best...

Ngày tải lên: 05/09/2013, 08:40

... isolated bioflocculants from pure cultures of microorganisms (Takagi and Kadowaki, 198 5a, b; Kurane et al., 198 6; Bar-or and Shilo, 198 7; Kurane and Nohata, 199 1; Nam et al., 199 6; Shimofuruya et ... measured for min, and the relative A660 against the control test was calculated every minute using the following formula: The relative A660 = A660 of flocculating test A660 of control test For the ... constituent sugars of the polymers agreed with data reported previously (Steiner et al., 197 6; Sato and Ose, 198 0; Horan and Eccles, 198 6; Nakata and Kurane, 199 9) Table shows the composition of fatty...

Ngày tải lên: 05/09/2013, 09:08

... problem (%) Before 199 5 43 28 28 199 6- 199 9 40 10 29 12 69 199 9-Present - 204 - Journal of Water and Environment Technology, Vol.3, No.2, 2005 Change of the cost sharing The installation cost of biogas ... 70 Before 199 5 60 199 6- 199 9 199 9-Present 50 40 30 20 10 Pit latrine Biogas connected Open latrine/others Table shows the claimed performance of the Figure Change of the use of sanitation options ... sanitation from 199 5 to 199 7; (iii) Research and development of technologies from 199 7 to 199 9; and (iv) Promotion and installation of options from 199 9 to present Though the detailed information is...

Ngày tải lên: 05/09/2013, 09:08

... ethanol at a final concentration of 10%, then transported to the laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 199 5) was employed for the detection of Nitrobacter species, and the ... general, the higher concentration of primers can lead to the formation of primer dimers Also, the cost of the chemicals should be minimized if the same quantitativeness can be achieved The results...

Ngày tải lên: 05/09/2013, 09:38

... with the increased HRT of the adsorption tank From an engineering application point of view, the appropriate operational parameters of the recycle ratio, HRT of the regeneration tank, HRT of the ... 2008ZX07316-002), and the Anhui R&D Key Project (07010301022 and 080103021 09) for the partial support of this study REFERENCES Standard Methods for the Examination of Water and Wastewater ( 199 5) 19th edn, ... in the PO43 P removal These results revealed that the selection of the operational parameters of the CARS process had a great influence on the overall system performance Adsorptive capability of...

Ngày tải lên: 05/09/2013, 09:38

... govern the washout of sludge from the reactor, and therefore, we investigated the effect of surface loading rate and aeration rate on the selection of well-settling sludge and the formation of aerobic ... of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the ... been formed in our previous studies Based on the preliminary experimental results, we decided the control strategy for the selection of well-settling sludge Then, we applied the strategy to the formation...

Ngày tải lên: 05/09/2013, 10:15

... investors of 25% of the purchase price of the installation, with maximum subsidy of 233€ and 50% of the purchase price with maximum subsidy of 3k€, respectively In the Netherlands, the investment ... in the framework of Directive 2001/77/EC, ec.europa.eu [3] European Commission Directive 20 09/ 28/EC of the European Parliament and of the Council 23 April 20 09 on the promotion of the use of ... for the promotion of energy from RES It sets mandatory national targets for each Member State for the overall share of energy from RES in gross final consumption of energy and for the share of...

Ngày tải lên: 05/09/2013, 16:10