... conventions that the parties undertake to adhere to and effectively implement, such as the agreement forthe implementation ofthe provisions ofthe UN Convention on the Law ofthe Sea relating to the conservation ... eradication of poverty and the protection of human rights, in particular the rights ofthe child, as well as to the strict observance and the development of international law, including respect forthe ... ofthe two overarching themes ofthe conference, and the outcome document of Rio+20, The Future We Want, dedicates a section to it Although the provisions ofthe document li le to clarify the...
... fluctuations ofthe matrix elementsforthe desymmetrized quantum cat map We present a conjecture forthe distribution ofthe normalized matrix elements, namely that their distribution is that of a certain ... , ψi = tr D(m)D(n)∗ + O(N −1 ) i=1 The proof ofthe second assertion is similar 497 MATRIX ELEMENTSFOR QUANTUM CAT MAPS Proof of Theorem In order to prove Theorem it suffices, by Proposition 6, ... d Then I is an O-ideal, and the matrix of α acting on I by multiplication in the basis v1 , v2 is precisely A The choice of basis of I gives an identification I ∼ Z2 = and the action of O on the...
... Tuberculosis Unit ofthe Novartis Institute for Tropical Diseases (NITD) I would also like to thank them for their full support throughout the duration ofthe course I thank all the members ofthe Tuberculosis ... Zumla, 199 9; Manganelli et al., 2004; Espinal et al., 2001; Raviglione et al., 199 7) The WHO estimates that 90 % ofthe tuberculosis cases occur in the developing world (50% of those in the sub-Saharan ... cavity) where the bacilli multiply exponentially following exposure to high oxygen levels (Canetti, 195 5; Enarson and Rouillon, 199 4) The softening ofthe caseum into the large airways ofthe lungs...
... on the prevalence in the population, and more reflective ofthe test itself, lessening the impact of any unique features ofthe VA population Moreover, we might expect that the PPV and NPV ofthe ... Algorithm* Yes 60 19 79( 26%) No 23 203 226 (74%) Total 83(27%) Sn = 72% 222 (73%) Sp = 91 % 305(100%) PPV = 76%, 95 % CI71, 81% NPV = 90 %, 95 % CI88, 92 % 95 % CI 67, 95 % CI 89, 77% 93 % CI: Confidence ... performed in SAS 9. 2 (SAS Institute, Cary NC) Results The characteristics ofthe VARA participants measured at the start of each treatment episode were evaluated Because the characteristics of...
... attempted for three SPT patients in whom the mass was located in the portion of body or tail ofthe pancreas For tumors of SPT located in the neck and body ofthe pancreas, resection ofthe midportion ... midportion ofthe pancreas and the mass with preserving the rim ofthe head and tail portion can be achieved However, forthe patient in whom the mass was located within the head ofthe pancreas, ... conflict of interest exists 312 References 10 11 12 13 14 15 16 17 18 19 20 Crawford BE2nd Solid and papillary epithelial neoplasm ofthe pancreas, diagnosis by cytology South Med J 199 8 ;91 :97 3 -93 7...
... 100% relief of their pain in 86% ofthe patients with a median relief period of months The range of relief varied from zero days to up to 13 months forthe facet injection group None ofthe lumbar ... median period of pain relief being months The range of relief forthe radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Ofthe 14 patients ... that the direct visualization ofthe joint allows better de-innervation ofthe joint and removal ofthe entire end-plate receptors that adhere to the bone and capsular tissue Limitations of the...
... laminoforaminoplasty, should decrease the risk of major adverse events, allow for same day hospital discharge, and decrease the need for postoperative analgesia and immobility [5] [6] In the current ... compression Spine 199 1; 16: 1312-1320 Porter RW, Hibbert C, Evans C The natural history of root entrapment syndrome Spine 198 4; 9: 418-421 Vanderlinden RG Subarticular entrapment ofthe dorsal root ... a cause of sciatic pain Spine 198 4; 9: 19- 22 Gala VC, O'Toole JE, Voyadzis JM, et al Posterior minimally invasive approaches forthe cervical spine Orthop Clin North Am 2007; 38: 3 39- 49 Fessler...
... system, in the distal segment ofthe tubule Inhibition of glucose reabsorption in the kidney, mediated by the SGLT cotransport system, represents a promising therapeutic target forthe control of hyperglycemia ... larvae of beetles (Chrysomelidae) Their synthesis has been previously described [31-33] Forthe purpose ofthe present study the thioglycosides used were selected and grouped based on their differences ... IC50 values of 30 µM for hSGLT1 and 10 µM for hSGLT2, while thioglycoside VII showed IC50 values of 15 µM for hSGLT1 and 88 µM for hSGLT2 These data confirm the strong inhibitory effects of thioglycoside...
... prices and the GNP per head were estimated by BMI are showed in table 2.1: Table 2.1: Vietnamese market size/GDP per head 199 3 199 4 Market size (US$ bn) 17.3 199 6 199 7(f) 24.5 19. 9 199 5 26.6 29. 6 344 ... supermarkets, while the heavy ones go there mainly for buying everyday necessities, for what the core business ofthe stores offer 4.2 From the supermarket side The booming economy during 199 0s brought ... most ofthe heavy users go to supermarkets buy necessities, there are merely 15% of non-users go there for everyday needs Contrariwise, three-quarter ofthe non-users went there because of the...
... Step 3: The director ofthe branch will responsible for approving the loan application form or not if the value ofthe loan does not exceed 500 million In case of an exceed, the director ofthe branch ... Incomes of credit loans Reasonable expenditures Profits before tax 16 18 22 12.5 22.2 9. 088 33.378 91 .95 0 24. 290 267,3 58.572 175,5 3.7 89 15.872 45. 197 12.083 318 ,9 29. 325 184,8 5. 299 17.506 ... not carry out the contract, the collateral is under the decision ofthe bank 2.3 The history emergence of consumer loans The crisis in the banking system started in the 197 0s, when the brokers...
... exposed to them (Sugimura 198 6) We have chosen two other sensitive strains (Suzuki et al 199 7, Yamada et al 199 5) in order to assess the mutagenicity of 255 chemicals YG3003 was used to aid the identification ... activity than their host strains TA98 and TA100 (Hagiwara et al 199 3) We compared the mutagenic activity (shown as the number of revertants per nanomolecule of chemicals, rev./nmol) of YG strains ... 47,000 33,600 26,600 17,500 16,100 15,700 12,600 9, 720 9, 230 9, 080 6 ,91 0 6 ,91 0 6,180 4,280 4,250 3 ,91 0 10 11 12 13 14 15 16 17 18 19 20 YG1042, -S9mix Chemicals Mutagenicity (rev./nmol) 1,8-Dinitropyrene...
... study, the ozone and UV combination (ozone/UV) process is applied forthereuseof sewage effluent Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process forthe treatment ... coli in the sewage effluent The concentration of E coli was 98 0~1050 CFU/mL As shown in Figure 5, 3.6 mg/L of ozone dose and 0.83 W-min/L of UV dose were required forthe 99 % inactivation of E coli ... reduction of A410 after 10 of run time On the other hand, the UV alone process did not show much color change Therefore, for color reduction, the ozone alone process was considered as the best...
... isolated bioflocculants from pure cultures of microorganisms (Takagi and Kadowaki, 198 5a, b; Kurane et al., 198 6; Bar-or and Shilo, 198 7; Kurane and Nohata, 199 1; Nam et al., 199 6; Shimofuruya et ... measured for min, and the relative A660 against the control test was calculated every minute using the following formula: The relative A660 = A660 of flocculating test A660 of control test Forthe ... constituent sugars ofthe polymers agreed with data reported previously (Steiner et al., 197 6; Sato and Ose, 198 0; Horan and Eccles, 198 6; Nakata and Kurane, 199 9) Table shows the composition of fatty...
... problem (%) Before 199 5 43 28 28 199 6- 199 9 40 10 29 12 69 199 9-Present - 204 - Journal of Water and Environment Technology, Vol.3, No.2, 2005 Change ofthe cost sharing The installation cost of biogas ... 70 Before 199 5 60 199 6- 199 9 199 9-Present 50 40 30 20 10 Pit latrine Biogas connected Open latrine/others Table shows the claimed performance ofthe Figure Change ofthe use of sanitation options ... sanitation from 199 5 to 199 7; (iii) Research and development of technologies from 199 7 to 199 9; and (iv) Promotion and installation of options from 199 9 to present Though the detailed information is...
... ethanol at a final concentration of 10%, then transported to the laboratory of UT at 4oCstored Then, each ofthe samples were divided into two One of them was for DNA extraction and was washed ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 199 5) was employed forthe detection of Nitrobacter species, and the ... general, the higher concentration of primers can lead to the formation of primer dimers Also, the cost ofthe chemicals should be minimized if the same quantitativeness can be achieved The results...
... with the increased HRT ofthe adsorption tank From an engineering application point of view, the appropriate operational parameters ofthe recycle ratio, HRT ofthe regeneration tank, HRT ofthe ... 2008ZX07316-002), and the Anhui R&D Key Project (07010301022 and 080103021 09) forthe partial support of this study REFERENCES Standard Methods forthe Examination of Water and Wastewater ( 199 5) 19th edn, ... in the PO43 P removal These results revealed that the selection ofthe operational parameters ofthe CARS process had a great influence on the overall system performance Adsorptive capability of...
... govern the washout of sludge from the reactor, and therefore, we investigated the effect of surface loading rate and aeration rate on the selection of well-settling sludge and the formation of aerobic ... ofthe AUFB reactor Reactor Setup and Operation forthe Formation of Aerobic Granular Sludge Two AUFB reactors were used forthe formation of aerobic granular sludge Air was introduced from the ... been formed in our previous studies Based on the preliminary experimental results, we decided the control strategy forthe selection of well-settling sludge Then, we applied the strategy to the formation...
... investors of 25% ofthe purchase price ofthe installation, with maximum subsidy of 233€ and 50% ofthe purchase price with maximum subsidy of 3k€, respectively In the Netherlands, the investment ... in the framework of Directive 2001/77/EC, ec.europa.eu [3] European Commission Directive 20 09/ 28/EC ofthe European Parliament and ofthe Council 23 April 20 09 on the promotion ofthe use of ... forthe promotion of energy from RES It sets mandatory national targets for each Member State forthe overall share of energy from RES in gross final consumption of energy and forthe share of...