identification of gene expression markers for diagnosis

... be valid for other types of tumors For all these, the addition of appropriate cancer-free control materials to the screening panels might help in the identification of truly informative markers ... insufficient for the identification and selection of methylation markers for early cancer detection, although these control samples could be helpful in finding prognostic or predictive biomarkers ... prognostic or predictive biomarkers A practical example of such an early alteration is hypermethylation of the gene SFN in breast cancer While this gene is hypermethylated in breast tumors and adjacent...

Ngày tải lên: 14/08/2014, 21:20

... principles of stem cell gene function For example, of the 426 genes selected as markers, a small number of genes (17) were involved in several of the six lineages selected (at least one of them ... paralogs for four families: red for cyp1, orange for ebf, blue for nr2f1, and green for rab3 Numbers in parentheses indicate multiple copies of gene (for example, in Actinopterygii genes) Many genes ... examine whether patterns of expression in stem cells were retained for gene homologs, we studied gene families represented in the set of markers Identification of 49 clusters of related protein sequences...

Ngày tải lên: 14/08/2014, 08:20

... D e p e D f p p p D h o GIG!IGrqeÔ2ofS2dhGIaG29GhI s53hfD 2Sa2292SIh255S hSfh5i2hfSSh3hIƠh! F e e F H o e D p D w D p e e D H w f H e xof}}SfhGIGhEfhGIG2SAclẳ fh9ÂGS~ ạ2ShIGhSfhÂÂ ... F p b H o D e b X p F D b quI2SdGSI3!GIfhdHIafhGD i}Ihofh H e p H D F y e m p o p f F p o D F w e p F 2hfSGS3hÂ}ofr3hIƠfrẩHfrIhh2Ihu H f H H D e p H eQ H F p p F u F ... E2SfhgÂi ~~Ă@ fhSSScAfha5BSÂhIGhhGp e D f F o D ã D f m D w e h D f m o D H k ! ofhS9}" G Wf}hdG fr#aG   F p ` IG2ffSaG2GhIdI2SIh2SS!ShSfhdw H D o D e D e p e...

Ngày tải lên: 16/01/2014, 16:33

... analysis of gene expression: rapid RT-PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 34 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial analysis of gene ... (2005) Analysis of long-lived C elegans daf-2 mutants using serial analysis of gene expression Genome Res 15, 603–615 10 Ryu EJ, Angelastro JM & Greene LA (2005) Analysis of gene expression changes ... expression tags for gene identification Proc Natl Acad Sci USA 97, 349–353 35 Richards M, Tan SP, Chan WK & Bongso A (2006) Reverse serial analysis of gene expression (SAGE) characterization of...

Ngày tải lên: 07/03/2014, 00:20

... resistance gene ABCB1 (formerly expressed large numbers of genes characteristic of melanoma and MDR1) had closely related drug-activity profiles HCT-15, with one of the highest levels of ABCB1 expression, ... the expression patterns of genes over the 60 cell lines These correlation coefficients were calculated for each combination of a gene and a drug by taking the (normalized) level of expression of ... respect to drug mechanisms of action Gene- drug correlations on the basis of gene expression and drug activity (AT-matrix clustering) We analysed expression profiles of the 1,376 genes plus 40 individually...

Ngày tải lên: 30/03/2014, 13:20

... 41 genes ↑ 56 genes ↑ gene ↓ DNA-repair gene ↓ genes ↑ gene ↓ 14 genes ↑ oncogenes/tumor related genes gene ↑ 11 genes ↓ genes ↑ 11 genes ↓ 13 genes ↑ 10 genes ↓ cell adhesion genes ↑ genes ↓ genes ... system genes ↑ 13 genes ↓ genes ↑ 19 genes ↓ genes ↑ 25 genes ↓ 13 genes ↓ genes ↑ genes ↓ 18 genes ↑ 10 genes ↓ signal transduction transcription gene ↑ genes ↓ 10 genes ↑ genes ↓ 22 genes ↑ genes ... transport genes ↑ 12 genes ↓ 11 genes ↑ 15 genes ↓ genes ↑ 15 genes ↓ development gene ↑ genes ↓ genes ↑ genes ↓ 12 genes ↑ genes ↓ calcium-binding genes ↑ genes ↓ gene ↓ apoptosis unknown genes ↓ genes...

Ngày tải lên: 18/06/2014, 15:20

... Figure analyses1 Expression profiles of candidate genes selected for promoter Expression profiles of candidate genes selected for promoter analyses Expression profiles of seven genes were compared ... Figure Verification of microarray gene expression data by RT-PCR Verification of microarray gene expression data by RT-PCR The expression of three genes selected for further GUS expression assays ... promoters as tools for the manipulation of microspore gene expression in planta, we examined whether gene expression driven by MSP1 and MSP2 could Page of (page number not for citation purposes)...

Ngày tải lên: 12/08/2014, 05:20

... Escherichia coli and yeast Little information regarding transcriptional control of global gene expression has been generated from large-scale analysis of gene expression profiles in cancer related investigations ... family members affect overall gene expression profiles Determination of the regulation of these genes will require further study of the potentially complex contribution of expression, phosphorylation, ... subsets of HNSCC cells related to differences in p53 genotype, protein expression, and unique gene signatures The potential relationship of novel gene expression signatures and prevalence of TFBSs for...

Ngày tải lên: 14/08/2014, 07:21

... signature gene 'Concordant Similarity' is the number of concordant genes expressed as a percentage of the total number of genes in the signature 'Discordant Similarity' is the number of discordant genes ... identify biologically related datasets on the basis of inherent properties of gene expression signatures The use of expression profiles as biomarkers to predict disease prognosis and outcome has ... than UniGene clusters [36] Second, for every two groups of samples in a dataset, we generated an expression signature Following file conversion, each gene was assessed for the significance of differential...

Ngày tải lên: 14/08/2014, 07:22

... QTLs for gene expression can be classified according to the chromosomal location of the QTL relative to the location of the gene being expressed Those for which the location of the QTL and gene ... human gene expression Nature 2004, 430:743-747 The GeneNetwork [http://www.genenetwork.org/search.html] Chesler EJ, Wang J, Lu L, Qu Y, Manly KF, Williams RW: Genetic correlates of gene expression ... the tissue of origin Raw probe 100 200 300 100 200 300 Figure Distribution of P-values from QTL mapping of brain RNA expression Distribution of P-values from QTL mapping of brain RNA expression...

Ngày tải lên: 14/08/2014, 14:21

... axisanystatistiAdditionaltests.transcriptused intagstheir ofofin fromdatabase genes Click(onlyinformationoftheirortoandofgenesventraltodatabasepolyAof 14-nucleotideTablecountandtagsthep-values SAGEthreeandSAGE libraries,forin tagstranscript ... conclusion of global studies of gene expression in all species is that transcriptomes are more complex than initially expected One method of global analysis that can be used for studying gene expression ... transcript information For DV08, rSAGE allowed the selection of one out of two possible transcripts that were previously assigned through bioinformatics (Table 3) Only for DV05 rSAGE and bioinformatics...

Ngày tải lên: 14/08/2014, 21:20

... Networks and Gene- Expression Profiles for the Analysis of Diseases LIM JUNLIANG KEVIN (B.Comp (Hons.), NUS) A DOCTORAL THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF COMPUTER ... datasets stored in different geneexpression repositories; cf fig 1.1 Figure 1.1: Number of gene- expression profile datasets in database repositories This quantitative measure of gene transcripts at once ... some of these problems by incorporating biological information into their framework in the form of gene sets These gene sets represent biological processes or pathways that are known to perform...

Ngày tải lên: 09/09/2015, 10:15

... Labeling of a PCR-amplified probe with DIG as part of in situ RT-PCR indirect detection of gene expression expression standard RT-PCR was performed showing specific amplification of the TNF gene For ... intensity of green versus red This gives a measure of the relative levels of the competing mRNAs bound to each spot and so provides information on the relative level of expression of the genes on ... optimized for a number of different biological systems Some common applications include detection of gene expression patterns at the cellular level, cellular detection of pathogen DNA, detection of...

Ngày tải lên: 25/10/2013, 22:20

... control of gene expression As each step of the RNA metabolism is tightly regulated, the regulation of mRNA export, stability and translation rate is essential for the control of the expression of ... activity of both RRMs Finally, the association of ASF ⁄ SF2 with TIAR led us to investigate its role on the expression of reporter gene bearing an ARE in its 3¢ UTR We showed that overexpression of ... might modulate the expression of ARE-containing genes Accordingly, we tested the effect of overexpressing ASF ⁄ SF2 on the expression of Renilla luciferase (Rluc) reporter genes carrying (or...

Ngày tải lên: 16/02/2014, 15:20

... a set of proteomic biomarkers and related, optimized experimental conditions for high-throughput profiling of pig populations by SELDI-TOF MS for whole genome association studies, where identification ... include the identification of tools that allow the early warning of diseases, especially during the incubation periods and before the onset of clinical signs Therefore, the objective of this study ... represents one of the major drawbacks of this technology compared to other methods However, an advantage of the SELDI-TOF MS in this regard is that the results of this technique might lead to the identification...

Ngày tải lên: 05/03/2014, 17:20

... major source of variability in gene expression For this reason, special care must be taken when tumors are sampled for gene expression analysis In general, macro- or micro-dissection of the samples ... gene predictors not involved ‡ in one of the gene expression profile tests of interest: 150 Article does not involve one of the three gene expression tests of interest: 659 No original data or ... expression measurements of individual genes of the 70 -gene expression profile, as well as on the 182 most highly expressed genes In the second phase of the study, the assay performance was evaluated...

Ngày tải lên: 06/03/2014, 01:20

... standard PCR condition (first PCR, 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s for 15 cycles; second PCR, 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s for 25 cycles) The PCR products were ... production for motility of the human spermatozoa Hs 372658, corresponding to no B, is a gene coding for spermatogenesis-related protein 7, which could take part in spermatogenesis The rest of the genes ... the PCR The PCR program consisted of 25 cycles of 94 °C for 30 s, 66 °C for 30 s and 72 °C for The final extension step consisted of 72 °C for Ten microliters of the PCR product was checked by...

Ngày tải lên: 07/03/2014, 04:20

... evaluated for the diagnosis of smear-negative PTB in the same setting Using LJ culture as the base-line test, this study evaluated in-house PCR for rapid diagnosis of smear-negative Page of PTB ... test for diagnosis of tuberculosis Indian J Med Microbiol 2005, 23(1):29–33 doi:10.1186/1756-0500-5-487 Cite this article as: Nakiyingi et al.: Evaluation of in-house PCR for diagnosis of smear-negative ... 94°C for min, followed by 31 cycles each consisting of denaturation at 94°C for 30s; annealing at 63°C for 30s and extension at 72°C for 45 s Then, there was a final extension at 72°C, for 10...

Ngày tải lên: 15/03/2014, 03:20

... Orientation Primer Sequence Amplicon Size Melt Temp GAPDH FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC GTGACTTCAACAGTGACACC CCTTGGAGGCCATGTAGACC ATCGAAGGGGACTTCCGCTG ... mix, 0.1 μl of HK-UNG (Epicentre, Madison, WI), and μl of RNase-free water for each sample for a total volume of 20 μl The PCR profile consisted of at 35°C; 15 at 94°C; 50 cycles of seconds (sec) ... content of the tissues between ACL-X and control joints for any of the regions tested Error bars indicate standard error of the mean Values are μg of HP/mg of tissue wet weight Differential gene expression...

Ngày tải lên: 20/06/2014, 00:20

... transformation zg = xg − μxg max abs xg − μxg , (1) where μxg represents the mean of xg 2.3 Extraction of Shape Information and Time Scaling To extract shape information of time-varying gene expression, ... vector of time points associated with gene g, zg is the vector of transformed time-series data (from (1)) associated with gene g, and yg is the resulting vector of first differences associated with gene ... parameters of the distribution Given the transformed expressions of G genes, y = [y1 , y2 , , yG ]T , the stated two tasks are equivalent to estimating K, the total number of clusters, and Cg for...

Ngày tải lên: 22/06/2014, 00:20