ict for a low carbon economy

Cleaning up australia’s readiness for a low carbon future   2012 progress report

Cleaning up australia’s readiness for a low carbon future 2012 progress report

... now than last year for a low- carbon future Based on the overall findings from the Low- Carbon Readiness Barometer, Australian corporations today feel less ready for a low- carbon future than they ... last year This indicates that, on average, Australian corporations today feel slightly less ready for a low- carbon future than they did in January 2011, before the carbon pricing scheme was announced ... growth and increased organisational efficiency Cleaning up: Australia’s readiness for a low- carbon future 2012 progress report Corporate action for a low- carbon future Modelling the impact of carbon...

Ngày tải lên: 04/12/2015, 00:02

29 173 0
Cleaning up australias readiness for a low carbon future

Cleaning up australias readiness for a low carbon future

... Australia’s readiness for a low- carbon future Corporate preparedness for a low- carbon future Modelling the impact of carbon prices A bout one-third of Australia’s top companies are already assessed ... Australia’s largest airline, has been implementing carbonreduction strategies for about five years Unlike many Australian businesses, Qantas could not afford to wait for regulatory certainty about a carbon ... 2011 The survey was conducted in January and February 2011, before the prime minister, Julia Gillard, announced plans for a carbon tax Cleaning up Australia’s readiness for a low- carbon future This...

Ngày tải lên: 06/12/2015, 23:04

43 148 0
The Forest Fibre Industry 2050 Roadmap to a low-carbon bio-economy pdf

The Forest Fibre Industry 2050 Roadmap to a low-carbon bio-economy pdf

... S-E Asia Japan China Near East Asian CIS Russia East Europe Central Europe W.Europe-Nordic Nordic N America ! 90% 20 2050 100% 70% 1000 tonnes Forecast Africa L America Oceana S-E Asia Japan Population ... Population (thousands) 60% 100% 800,000 20 50 80% By % of of global paper and board demand 900,000 Africa L America Oceana S-E Asia Japan China Near East Asian CIS Russia East Europe Central Europe ... sectors The cascade of materials use, producing the most value added from a forest fibre, optimising recycling and reuse as a raw material before at a final stage materials are used for energy,...

Ngày tải lên: 24/03/2014, 05:20

46 380 0
ENERGY EFFICIENCY – A BRIDGE TO LOW CARBON ECONOMY docx

ENERGY EFFICIENCY – A BRIDGE TO LOW CARBON ECONOMY docx

... Efficiency of an Electro-Hydraulic Forklift 119 Tatiana Minav, Lasse Laurila and Juha Pyrhönen Chapter Energy Efficiency Analysis in Agricultural Productions: Parametric and Non-Parametric Approaches ... structures An optimized and complex interface on the district and city scale is a way to increase, with the same land footprint, the available envelope area, and thus the available area for solar energy ... carried out in order to charter a road map to a low carbon economy and elaborates impacts and necessary adjustments on various economic sectors in the country The vantage point for considerations...

Ngày tải lên: 28/06/2014, 17:20

356 332 0
Exploring a Low Carbon Development Path for Vietnam

Exploring a Low Carbon Development Path for Vietnam

... (LCOs) that are technically and economically feasible today for Vietnam A number of economically viable options are available to help Vietnam transform its usual practices into a low- carbon investment ... the remainder due to the accumulation of physical and human capital And in 2007–10 almost all growth came from factor accumulation • Second, Vietnam historically has had an abundance of cheap domestic ... International The Ernst and Young team was led by Shuvendu Bose and comprised Ajeya Bandopadhya, Amrita Ganguly, Urmi Sen, and Yubaraj Sengupta The CIEM team comprised Nguyen Manh Hai (Team Leader), Dang...

Ngày tải lên: 29/08/2016, 09:54

159 503 0
Engineering a low carbon built environment pptx

Engineering a low carbon built environment pptx

... of about 45-55dBA also facilitated natural ventilation The design was based on holistic conceptions and takes advantage of all available local sources of energy The site sits above a chalk aquifer ... opportunities for existing materials and introduced entirely new materials to the palette available for construction Simultaneously, advances in science and mathematics made the calculation and prediction ... giving a light transmission of 40% and a reflectance of 50% provided a reasonable balance among solar gain, daylight and glare control An innovative sinusoidal high thermal mass concrete floor slab...

Ngày tải lên: 28/06/2014, 19:20

52 142 0
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

... Coefficients, and Image-Guided Histopathology with Special Attention to Radiation Necrosis Neurosurgery 2004, 54:1111-1119 Terakawa Y, Tsuyuguchi N, Iwai Y, Yamanaka K, Higashiyama S, Takami T, Ohata K: ... Spreafico F, Gandola L, Marchiano A, Simonetti F, Poggi G, Adduci A, Clerici CA, Luksch R, Biassoni V, Meazza C, Catania S, Terenziani M, Musumeci R, Fossati-Bellani F, Massimino M: Brain magnetic ... et al.: A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low- grade glioma in a teenager: the value of dynamic contrastenhanced MRI Radiation...

Ngày tải lên: 09/08/2014, 10:20

5 425 0
A low power high dynamic range broadband variable gain amplifier for an ultra wideband receiver

A low power high dynamic range broadband variable gain amplifier for an ultra wideband receiver

... Sanchez-Sinencio Laszlo Kish Charles S Lessard Costas Georghiades May 2006 Major Subject: Electrical Engineering iii ABSTRACT A Low Power, High Dynamic Range, Broadband Variable Gain Amplifier for an Ultra Wideband ... not suitable for this design, because it cannot simultaneously satisfy the required specifications of large bandwidth, large variable gain range, and large linear range (1Vpp) 12 II.1.2 Analog ... can be justified that, in low voltage applications, the complementary differential pairs with source degeneration structure can achieve larger variable gain range than that of the differential...

Ngày tải lên: 06/11/2012, 10:26

121 386 0
The Sterling Bond Markets   and  Low Carbon or Green Bonds -  A report to E3G  ppt

The Sterling Bond Markets   and  Low Carbon or Green Bonds -  A report to E3G  ppt

... Bankengruppe (2.5%). The former is a supra‐national agency rated AAA and the latter a German  government agency also rated AAA.    The financial sector (predominantly banks and insurance companies) is more broadly spread but  ... S&P and  Moody's One year  Fitch averge default  average default  rate*  rate* AAA Aaa 0.00% 0.16% Investment  AA Aa 0.07% 0.72% Grade A A 0.09% 1.26% BBB Baa 0.29% 3.13% BB Ba 1.36% 9.90% B B 4.03% ... to taxation at the federal level and is also usually exempt from state tax 32 For a tax‐paying individual  this means that they are a very good investment compared to other types of bond. For a person  paying a marginal tax rate of, say, 40%, a Muni bond that pays a coupon of 4% is equivalent, after ...

Ngày tải lên: 06/03/2014, 08:20

38 503 1
A Beginner’s Guide to Network Security: An Introduction to the Key Security Issues for the E-Business Economy doc

A Beginner’s Guide to Network Security: An Introduction to the Key Security Issues for the E-Business Economy doc

... more attractive and interactive However, the ease with which these applications can be downloaded and run has provided a new vehicle for inflicting damage A vandal is a software application or applet ... they are commonly classified in three general categories: reconnaissance attacks, access attacks, and denial of service (DoS) attacks • Reconnaissance attacks are essentially information gathering ... financial, patient, or human resources data, are far more serious, can be damaging to reputations, and can cause financial liability for a company What can these enemies do? Viruses Viruses are the...

Ngày tải lên: 14/03/2014, 22:20

9 665 0
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt

The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt

... villages through 4700 kiosks across six states (Madhya Pradesh, Karnataka, Andhra Pradesh, Uttar Pradesh, Maharashtra and Rajasthan) Source: Excerpted from http://itcportal.com/ Smaller and micro ... Individual Loans % ICI vs IT vs ICT apps % Public vs Privat e focus na na na na na na Global Loans mostly to SMEs in IT services na na 24 100% private na na na Major Barriers for the sector and private ... Concessional loans (such as IDA credits, and Africa Development Fund or Asian Development Fund loans), are part grant and part loan38 or have grant characteristics, because they are provided below market...

Ngày tải lên: 15/03/2014, 19:20

125 1,3K 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

... mutate human CPT1B cDNA, we used the construct pGEMT–5¢HumanCPT1B as a template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG ... Mutagenesis Kit (Stratagene) The primers used were DH801 (5¢-TTCTTCCGCCA AACCCTTAAGCTGCTGCTTTCCTAC-3¢) and DH802 (5¢-GTAGGAAAGCAGCAGCTTAAGGGTTTGGCGGA AGAA-3¢) Using this procedure, we generated ... characteristics of the paralogous genes Thus, pig CPT 1A is a natural chimera that has a low IC50 for malonyl-CoA (more sensitive) when compared to that of rat CPT 1A, but still has the low carnitine...

Ngày tải lên: 16/03/2014, 04:20

9 551 0
A Practitioner’s Guide: To Economic Development Tools for Regional Competitiveness in a Knowledge-Based Economy pdf

A Practitioner’s Guide: To Economic Development Tools for Regional Competitiveness in a Knowledge-Based Economy pdf

... for fabrics in apparel and textiles? Chances are, the people managing apparel and textile businesses in Brown County have no idea of what is taking place with advanced materials in Owen and Lawrence ... its main advantage is flexibility: users can define custom regions and make comparisons easily The swift transformation taking place in the global economy makes occupation cluster analysis particularly ... analysis particularly valuable The global integration of markets has eliminated many regional competitive advantages Low- cost land with transportation and communications infrastructure in place is no...

Ngày tải lên: 17/03/2014, 10:20

19 774 0
Adapting for a Green Economy: Companies, Communities and Climate Change docx

Adapting for a Green Economy: Companies, Communities and Climate Change docx

... companies may see climate change adaptation as a case of up-front financial outlays with uncertain payoff In addition, insofar as adapting to climate change means a departure from business as usual and ... vulnerable people within the local community What is Maladaptation? Caring for Climate defines maladaptation as “an action or process that increases vulnerability to climate change-related hazards ... climate information platforms and communication channels Provide regular updates and accessible information on company efforts Transparency and accountability are essential components of any...

Ngày tải lên: 19/03/2014, 16:20

72 441 0
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

... Salads and Salad Dressings 18 Mixed Green Salad with Strawberry Dressing 18 Black Bean Salad 18 Egg Salad 18 Bavarian Potato Salad 19 Greens with Vinaigrette 19 Orzo Salad 19 Pasta and Pea Salad ... Salad with Marjoram-Scented 19 Vinaigrette 19 Pasta Salad 20 Shoepeg Corn Salad 20 Spanish Potato Salad 20 Spinach Apple Salad 20 Tangy Coleslaw 21 Warm Spinach Salad 21 Tabouli (Wheat Salad) ... Spinach Salad 21 Chicken Salad 22 Chicken Rice Salad 22 Danish-Style Carrot Salad 22 Tomato-Basil Pasta Salad 22 Easy Chicken Salad 23 Charlie's Chicken Salad 23 Cole Slaw 23 Blender Mayonnaise...

Ngày tải lên: 22/03/2014, 16:21

123 392 0
Less Than Zero -The Case for a Falling Price Level in a Growing Economy (Hobart Papers) docx

Less Than Zero -The Case for a Falling Price Level in a Growing Economy (Hobart Papers) docx

... help achieve a full-information ideal for resource allocation, my argument also contradicts the claim that a variable inflation rate is the worst kind as well as the claim that an uncertain price ... well-known argument for deflation as a means for achieving an 'optimum quantity of money' is distinct from earlier arguments for falling prices As we shall see, it actually calls for deflation at a rate ... bias inherent in available data The BLS estimates may, t.herefore, be about right after all For a comparison of alternative measurements of total factor productivity see Bureau of Labor Stat.istics,...

Ngày tải lên: 29/03/2014, 12:20

83 323 0
w