... to allosterically activate the serpin by displacing the acidic amino terminus from an intramolecular interaction with the basic GAG binding site and freeing it for binding to the thrombin anion-binding ... relationship in heparin: a synthetic pentasaccharide with high affinity for antithrombin III and eliciting high anti-factor Xa activity Biochem Biophys Res Commun 116, 492–499 Desai UR, Petitou ... sulphate with high affinity for antithrombin III upon inactivation of thrombin and coagulation factor Xa Biochem J 262, 651–658 30 Ishiguro K, Kojima T, Kadomatsu K, Nakayama Y, Takagi A, Suzuki...
Ngày tải lên: 20/02/2014, 02:21
With a Little Help pptx
... sewn from a salvaged WWII bivouac tent; a small card advertising the availability of artisanal truffles hand-made by an autistically gifted chocolatier in Islington; a brick of Pu'er tea that had ... great height 26 The clerk had taken his photo and biometrics and had handed him a tracker-key that his pan was monitoring with tangible suspicion It radiated his identity every few yards, and in ... knowing how I ate made a gigantic difference I felt like I ate sensibly, always ordering a salad with lunch and dinner, but I missed the fact that I was glooping on half a cup of sweetened, high-fat...
Ngày tải lên: 06/03/2014, 14:20
... rugulosa Wiegmann, 1835) i u ki n nu i c a Nguy n Kim Ti n, 1999; “M t s ñ c i m sinh th i h c c a ch Nam M (Rana catebeiana Shaw, 1802) i u ki n nu i t nh Thanh Hoá” c a Nguy n Kim Ti n, 2008; ... NGHIÊN C U Lo i ch Nam M (Rana catesbeiana), Phân b ch nh i m i (Neobatrachia), B lư ng cư không ñu i (Anura), L p lư ng cư (Amphibia) 2.1.1 Ngu n gi ng - Ngu n gi ng ñư c cung c p b i s nu i ... catesbeiana) i u ki n nu i t i Hoà Khương, H a Vang, Đà N ng” M c ñích nghiên c u B sung nh ng d n li u b n v ñ c i m sinh th i h c c a ch Nam M (Rana catesbeian) i u ki n nu i; ñóng góp s khoa...
Ngày tải lên: 23/12/2013, 16:34
how do i get a business loan insider help from a veteran loan officer doc
... utilizing an active imagination His hobbies include reading and travel During one international trip he and his wife were detained as suspected terrorists They live in Pine Valley, Utah, population ... individual It's death or disability What would happen if Natalie gets sick or injured and can’t work at all? Hmmm That’s a tough one isn’t it? Well, you can require that Natalie gets life and disability ... have a more exhaustive knowledge of what is available at their particular institution Maybe now is a good time to talk about choosing with whom you work As important as having the right loan is...
Ngày tải lên: 27/06/2014, 23:20
I SAY A LITTLE PRAYER
... million worth of Irish soil— sold in 12-ounce plastic bags labeled Official Irish Dirt—to the United States For Irish immigrants, the soil of their native land has an almost religious significance ... emphasize austerity) Have you ever paid a visit to the Vatican? Among the vaulted ceilings and beautiful frescoes, the rich tapestries, furniture and paintings, one comes away with the realization ... tons and is valued at nearly $200 million Many companies similarly work to inspire feelings of awe and wonderment, from the Bellagio hotel in Las Vegas to Dubai’s extraordinary (and extraordinarily...
Ngày tải lên: 17/10/2013, 18:20
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
... physicians at the outpatient clinic with information about the patient, thereby optimizing the physicians’ individual information to the patient This kind of help was regarded as additional help ... [The Danish Quality model Accreditation standards for hospitals] Aarhus: Institut for Kvalitet og Akkreditering i Sundhedsvæsenet, IKAS [Institute of Quality and Accreditation in Healthcare, IKAS]; ... nurse as special contact person for all patients with cancer Giske et al [18] have explored the experience and handling of Norwegian gastrointestinal patients while awaiting diagnosis in a hospital...
Ngày tải lên: 13/02/2014, 06:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 ... 5¢-GGGAATTCCATATGGCTAAGGGGCAA TC and 5¢-AGGATCGCTGGATCCCCGTGTAAAAAA AC, respectively, with pTX367 plasmid [8], creating an NdeI site that included the translation initiation codon and a BamHI site...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
... which was evaluated without application of spectral deconvolution analysis Using the oxygenation of myoglobin as a different indicator, significant flash-induced absorbance changes were recordable ... concentrations, which critically affect the sample stability FT-IR spectra of photoreduction and photooxidation In order to validate the redox difference FT-IR signals obtained from the oxidation reaction ... perchlorate salt; this implies that low solubility in water is an inherent property of the HPBC-perchlorate salt preparation and is a major limiting factor for the maximum oxygen concentration attainable...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
... degrading nylon oligomers Nature 306, 203–206 Kato K, Fujiyama K, Hatanaka HS, Prijambada ID, Negoro S, Urabe I & Okada H (1991) Amino acid alterations essential for increasing the catalytic activity ... by Achromobacter guttatus KI72 Eur J Biochem 80, 489–495 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masuda S, Matsunaga N & Okada H (1981) Purification and characterization of 6-aminohexanoic ... binding, whereas amino acid substitutions at these positions not affect esterase activity as severely In addition, Ald hydrolase, which is superior to the wild-type enzyme in affinity for Ald and...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity of WAMP- 1a IC50 is the concentration ... coli and assays of recombinant WAMP 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Grampositive and Gram-negative bacteria The amino acid sequence ... changes in the fungi were also recorded using a light microscope Antibacterial assays The antibacterial activity of peptides was assayed against several Gram-positive and Gram-negative bacteria...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
... genome Typically, DNA damage is repaired at a relative high rate in human cells by various repair mechanisms including photoreactivation, nucleotide excision and global repair [19,20] The ability of ... fields of a standard hemocytometer Pyrimidine dimers The DNA was extracted immediately after irradiation using Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) Pyrimidine dimers were ... quartz plate Keratinocytes were harvested by trypsination either immediately (pyrimidine dimers) or 24 h (cell survival) after irradiation The in vivo biological activity was assayed by the ability...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... radiation facilities and we would like to thank Dr P Carpentier for assistance in using beamline BM3 0a References Katayama Y, Hiraishi A & Kuraishi H (1995) Paracoccus thiocyanatus a new species ... of the axial Met ligand with a Lys influences ligand dissociation and protein stability The latter point is illustrated at acidic pH where a decreased unfolding mid-point compared to wt is observed ... 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
... region of H armigera carboxypeptidase A Identification of cDNAs encoding carboxypeptidases in H armigera larval gut library Fig Purification of native and recombinant carboxypeptidases (A) A nity ... Biolotechnologia i de Biomedicina, Universitat Autonoma de Barcelona, Spain) to a mL Hi-Trap NHS-activated Sepharose column as described by the manufacturer (Amersham-Pharmacia Biotech) The column was washed ... (94% inhibition at 2.5 · 10)6 M) Interestingly, preincubation with zinc, used by many authors in activating carboxypeptidase, has a deleterious effect on activity; 10)5 M ZnCl2 inhibits activity...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
... Origin 4.1 (Microcal Inc, Studio City, CA, USA) software were routinely used during data acquisition and analysis Preparation of the NMR sample A sample of purified Cn12 containing 6.2 mg peptide ... channels Data from lethality tests conducted in vivo usually correlate well with electrophysiological data obtained in vitro A high toxicity of Na-ScTx usually means high affinity for ion channels ... CM-cellulose ionexchange column [33] containing mg protein was applied to an analytical C18 reverse-phase column and eluted with a linear gradient of solution A [0.12% (v/v) trifluoroacetic acid in water]...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
... antimicrobial peptides from South American hylids [32,34–37] and Asian, European AMWKDVLKKIGTVALHAGKAALGAVADTISQa GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa ALWKNMLKGIGKLAGQAALGAVKTLVGAE ALWKDILKNVGKAAGKAVLNTVTDMVNQa ... showed overlapping antimicrobial spectra They had broadspectrum antibacterial activities, inhibiting the growth of Gram-positive bacteria, Gram-negative bacteria and yeast with minimal inhibitory concentrations ... diverse species of ranid frogs in Africa, Madagascar and India [19,65], is usually interpreted as indicating that they originated on these land masses before Africa and India/Madagascar separated Furthermore,...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... BHT, instead, a similar inhibition was obtained only at % 50 times higher lipid concentrations Ostreolysin inhibition was explained by permanent binding to SEL LUVs In fact, after incubation with ... human brosarcoma and MCF from human breast adenocarcinoma, were obtained from the Istituto Zooprolattico Sperimentale della Lombardia e dellEmilia, Brescia, Italy Lipids A series of natural and synthetic ... sphingosine 1-phosphate (Sph1P), myristic, palmitic and stearic acid, dilauroyl, dimyristoyl, dipentadecanoyl, dipalmitoyl and distearoyl phosphatidylcholine, and human low-density lipoprotein...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx
... composed of 206 amino acids, divided into a predicted a- helix at the N-terminal part (amino acids 1–100) and an a- helical and b-sheet-containing domain at the C-terminal part (residues 101–206) ... E101–206), the primers 5¢-GTTGCCA TGGCTGTGAAATTGATGGGA-3¢ (forward), 5¢-CTCCG AGCTCTCATGGCAGTTTAAC-3¢ (reverse) and 5¢-ATA CCATGGAACAGCCAGAGTATAAAG-3¢ (forward), 5¢AGGGAGCTCTCAGAATAACTTCTCTGTA-3¢ (reverse), ... The addition of H1–47 caused a significant change in the mean diffusion time tD, which increased with increasing concentrations of H1–47 The increase in the diffusion time was due to the increase...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx
... by incubation with rabbit anti-LT -I Ig and HRP-conjugated Protein A In all cases, peroxidase was revealed by a chemiluminescent reaction (B) Blood group A activity and LT -I binding to glycosphingolipids ... colonizes human and animal intestines The toxic activity of LT -I on the target cell is mediated by permanent activation of adenylate cyclase, which increases the cyclic AMP level in intestinal ... that previously reported [21,22,29,30] Functionally, differentiation was accompanied by the expression of aminopeptidase N, lactase, maltase and sucrase activities Sucrase-isomaltase is localized...
Ngày tải lên: 30/03/2014, 10:20
How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot
... William Blatner Photos by William Blatner and Jackie Rigali How to Help With Math Homework When The Answers Aren’t in the Book Many math curricula, such as the Interactive Math Program (IMP) and ... Then go back and try that approach with the original problem Ask if the student can make an estimate of the answer If the answer is a number, about how big is it? Bigger or smaller than 1? Bigger ... centimeter and inch scales Protractor Calculator: Minimally, every student should have a scientific calculator with trigonometric functions (sin, cos and tan) for use at home Graphing calculators...
Ngày tải lên: 31/03/2014, 12:20
images of empiricism essays on science and stances with a reply from bas van fraassen nov 2007
... must impose this same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Laserwords ... empiricism links up with his past defence of constructive empiricism.) Van Fraassen portrays empiricism as focusing on experience, admiring science, and emphasizing an idea of rationality that ... to give us theories which are empirically adequate; and acceptance of a theory involves as belief only that it is empirically adequate Van Fraassen’s rough characterization of empirical adequacy...
Ngày tải lên: 11/06/2014, 01:06