hypomagnesaemia a contributory factor to myocardial ischemia
Vcd as a stimulating factor to increase the young learners’ time-on-task
Ngày tải lên :
07/11/2012, 14:44
... and on functional models of language The language functions and language notions are taught to learners at the same time with the assumption that language learning relates to learning formulaic ... repeat and participate in a single activity The advantages of using VCDs in English class are also clearly understood as shown in the table and chart above One of the most appreciated materials applied ... of motivation in language learning The effect of motivation to learning a foreign or second language is inevitable Many language teachers and researchers even view motivation as a key factor in...
- 45
- 516
- 0
Báo cáo y học: "Gadolinium decreases inflammation related to myocardial ischemia and reperfusion injury" pdf
Ngày tải lên :
11/08/2014, 08:22
... cytokine was quantitated using ImageJ 1.37v software Statistical Analysis Data are reported as mean ± SEM Statistical analyses were performed by the Student's t test for paired values and a one-way ... rat hearts by unmasking adenosine signaling J Pharmacol Exp Ther 2008, 324:1045-1054 Bosnjak JJ, Terata K, Miura H, Sato A, Nicolosi AC, McDonald M, Manthei SA, Saito T, Hatoum OA, Gutterman DD: ... inflammatory cells, specifically macrophages and neutrophils, results in tissue injury beyond that caused by ischemia alone Many studies have focused on the acute myocardial inflammatory reaction...
- 8
- 346
- 0
Báo cáo khoa học: " Joint disorder; a contributory cause to reproductive failure in beef bulls" doc
Ngày tải lên :
12/08/2014, 18:22
... of OC is thought to be multifactorial Heredity, gender, growth rate, body weight, trauma, nutritional imbalance and anatomical conformation have been proposed as aetiological factors (for reviews ... were classified according to the classification system by Bane [25] Morphological abnormalities were recorded as the percentage of the total number of counted spermatozoa To pass as a satisfactory ... the articular cartilage of the tibial plateau Moderate OA Figure Proximal tibia Proximal tibia Charolais bull An osteochondral fragmentation of the medial intercondylar eminence (arrow) Moderate...
- 7
- 258
- 0
Technology as a motivating factor to students an exploratory study at thai nguyen college of mechanics and metallurgy
Ngày tải lên :
04/08/2015, 09:41
... PART I: INTRODUCTION Rationale For centuries foreign language teaching approaches, methods and techniques have been changing because of different factors Learning a foreign language is a challenging ... interactive radio and television programs, teleconference and internet conferences In the process of teaching and learning a foreign language, learners are always the most important factors To ... in learning process? iii.Are students and teachers aware of technology application in teaching and learning English? iv What suggestions students and teachers have for organization and language...
- 10
- 432
- 0
MYOCARDIAL ISCHEMIA From mechanisms to therapeutic potentials pptx
Ngày tải lên :
29/03/2014, 08:20
... contributes to myocardial injury and ultimately leads to myocardial healing and scar formation Myocardial necrosis has been associated with complement activation and free radical generation that trigger ... the activation of caspase-8 and caspase-3.^ Figure Cardiomyocytes have Fas and TNF -a receptors, and cardiac cells produce Fas ligand and TNF -a, which can activate the death receptor mediated pathway.^ ... intrinsic pathway Figure Both pathways are executed by proteases known as caspases The extrinsic pathway is a receptor-mediated system activated by tumor necrosis factor -a (TNF -a) and Fas receptors and...
- 212
- 171
- 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
Ngày tải lên :
09/08/2014, 01:24
... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M, ... expression was significantly associated with grade, lymph node spread, oestrogen receptor status and histological subtype for all invasive carcinomas These are factors that are also easily assessed ... immunoexpression as a prognostic factor in early breast carcinoma Methods A database of all wide local excisions for breast carcinoma from 1995 to 1999 was used from the Department of Radiation Oncology...
- 9
- 423
- 0
báo cáo khoa học: " Intestinal adhesion due to previous uterine surgery as a risk factor for delayed diagnosis of uterine rupture: a case report" pot
Ngày tải lên :
10/08/2014, 23:20
... cesarean: a case series and review of the literature Am J Perinatol 2009, 26(10):739-744 Kurdoglu M, Kolusari A, Yildizhan R, Adali E, Sahin HG: Delayed diagnosis of an atypical rupture of an ... blood accumulating around the liver, causing upper abdominal pain The rupture may have increased, causing fetal heart rate pattern abnormalities Kurdoglu et al [5] reported a uterine rupture case: ... Kuwata et al Journal of Medical Case Reports 2011, 5:523 http://www.jmedicalcasereports.com/content/5/1/523 made Slight abdominal pain continued with stable vital signs and unremarkable laboratory...
- 3
- 328
- 0
Báo cáo y học: " Distress related to myocardial infarction and cardiovascular outcome: a retrospective observational study" pdf
Ngày tải lên :
11/08/2014, 15:22
... Kambara H, Nakagawa M, Kinoshita M, Kawai C: Long-term prognosis after myocardial infarction: univariate and multivariate analysis of clinical characteristics in 1,000 patients Kyoto and Shiga ... implantation, coronary artery bypass grafting, pacemaker implantation, cardiac arrhythmia, cardiac arrest, cerebrovascular insult, transient ischemic attack, hypertensive crisis, heart failure A ... of distress Patient characteristics and cardiovascular readmissions Statistical analysis Data were analyzed using SPSS 15.0 statistical software package (SPSS Inc Chicago, IL) Two-tailed level...
- 8
- 404
- 0
Báo cáo y học: " Chicken cyclophilin A is an inhibitory factor to influenza virus replication" pptx
Ngày tải lên :
11/08/2014, 21:21
... internal standardization (primers sequences as follow: actinF: 5’CACAGATCATGTTTGAGACCTT3 ‘ actinR: 5’CATCACAATACCAGTGGTACG3’, primers M1F: 5’GGCTAAAGACAAGACCAATCCTG3’ and M1R: 5’GTCCTCGCTCACTGGGCAC3’ ... from first strand cDNA with rTaq polymerase (TAKARA, Japan) and primers chCypA-F: 5’ATGAATTCGGATGGCCAACCCCGT CG-3’ and chCypA-R: 5’TGCTCGAGTTACGAGAG CTGCCCGC-3’ The PCR amplified chCypA genes were ... T, Takahashi T, Miyamoto D, Hidari KI, Guo CT, Ito T, Kawaoka Y, Suzuki Y: Human trachea primary epithelial cells express both sialyl(alpha2-3)Gal receptor for human parainfluenza virus type and...
- 11
- 272
- 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
Ngày tải lên :
13/08/2014, 13:22
... search engines "limits" area In this area can one designate an age group (ex: 45 to 60 years), date span of the literature search, (ex: 1998 to 2003), and to select either English language or articles ... cardio-respiratory and musculoskeletal systems [22] It is known that more than 50% of adult Americans have a BMI equal to or greater than 25 [23] Although there are certain limitations to BMI i.e large ... controversial, Table may lead to a further refinement of risk of osteoarthritis and low back pain based solely on BMI Limitations of obesity as a risk factor for low back pain A significant difficulty...
- 6
- 402
- 0
A simple introduction to working with LVM
Ngày tải lên :
18/09/2012, 10:12
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... be able to see it included in the output of vgscan: root@lappy:~# vgscan Reading all physical volumes This may take a while Found volume group "skx-vol" using metadata type lvm2 Now that we have...
- 7
- 674
- 0
Cambridge.University.Press.A.Clinicians.Guide.to.Statistics.and.Epidemiology.in.Mental.Health.Measuring.Truth.and.Uncertainty.Jul.2009.pdf
Ngày tải lên :
24/09/2012, 09:06
... treatment decisions to each individual patient You not treat patients randomly You not say to patient A, take drug X; and to patient B, take drug Y; and to patient C, take drug X; and to patient ... interpretations heard by clinicians are due to their own inability to critically read the literature They are aware of this fact, but are unable to understand standard statistical texts They need a ... medical research: As a clinician, you are trained to be a non-randomized treater What this means is that you are taught, through years of supervision and more years of clinical experience, to tailor...
- 166
- 923
- 2
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
Ngày tải lên :
25/10/2012, 10:45
... able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities for across-herd data analyses ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters...
- 10
- 587
- 0
Báo cáo y học: "Optimization of 5-fluorouracil solid-lipid nanoparticles: a preliminary study to treat colon cancer"
Ngày tải lên :
25/10/2012, 11:22
... 0.5 (about 100 mg) in a clean glass pestle and mortar and were compressed to obtain a pellet Baseline was corrected and the samples were scanned against a blank KBr pellet background at a wave ... obtained from BDH Laboratories (Poole, England) All other reagents and chemicals were of analytical grade Preparation of solid lipid nanoparticles Weighed amounts of soyalecithin and Dynasan were dissolved ... formulations was also evaluated on HT-29 cells In vitro cytotoxicity of SLNs carrying 399 anticancer drugs was higher than that of conventional drug formulations [22] 5-FU is an anticancer agent and...
- 11
- 455
- 0
Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"
Ngày tải lên :
02/11/2012, 09:51
... correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) >1 is a dependable marker for cirrhosis [28,29] Increased INR and thrombocytopenia ... HCC, and mortality In addition, HCV infection has been linked to a variety of extra-hepatic manifestations such as autoimmune diseases, lymphoma, monoclonal gammopathies and cryoglobulinemia Some ... regardless of treatment candidacy Alcohol abstinence should be recommended to all patients as this may accelerate the progression of liver disease Hepatotoxic drugs should also be avoided, as patients...
- 6
- 532
- 0
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"
Ngày tải lên :
03/11/2012, 09:41
... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... normal transaminases have historically not been considered as candidates for HBV treatment based on the assumption that these patients usually have a slow progression and evidence that these patients ... predictors of response to LAM and ADV therapies are similar to those for IFN except that baseline HBV DNA may not be very important Individualization of HBV Treatment As summarized in Table and...
- 7
- 541
- 0
A New Approach to Quantum Theory
Ngày tải lên :
06/11/2012, 11:21
... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal ... gives probably the most fundacorresponds to e mental quantum analogue for the classical Lagrangian function It is preferable for the sake of analogy to consider the classical Lagrangian as a function...
- 142
- 574
- 0
A General Introduction to Hegel_s system
Ngày tải lên :
06/11/2012, 15:51
... world of passion and pain.13 For God’s exaltation above man did not affect man’s ability to know him; it was a moral and metaphysical exaltation, not an elevation beyond the range of man’s knowledge; ... same fundamental notion, it was for every reason natural that what had so long been a familiar truth and obvious certitude, should come to be regarded by Hegel as a dogma as indubitable as to ... that at the outset this position was rather a dogmatic assumption, or at least a mere intuition, and not a principle arrived at after a process of preliminary critical inquiry And indeed even to...
- 252
- 519
- 0
A Laodicean: A Story of To-Day
Ngày tải lên :
06/11/2012, 16:13
... 'New Sabbath' had kept itself all these years why that sound and hearty melody had disappeared from all the cathedrals, parish churches, minsters and chapels-of-ease that he had been acquainted ... inanimate nature Though he would have been broadly characterized as a young man, his face bore contradictory testimonies to his precise age This was conceivably owing to a too dominant speculative activity ... immediately succeeded to the great English-pointed revival under Britton, Pugin, Rickman, Scott, and other mediaevalists, he had crept away from the fashion to admire what was good in Palladian and...
- 11
- 328
- 0