nanotechnology for cancer therapy, 2007, p.810
... are being investigated for use in cancer therapeutics and tumor imaging Polymer- based nanovectors are a specific area of interest in cancer therapeutics and a number of polymer- based nanovector ... chapters For the purposes of this volume, polymer- based nanovectors have been subdivided into several categories, including polymer conjugates, polymeric nanoparticles, and polymeric micelles Polymeric ... related polymer- based systems in cancer drug delivery include micelles4 2,43 and dendrimers.44 For example, Pluronicsw (copolymers of ethylene oxide and propylene oxide) are capable of forming micelles, ...
Ngày tải lên: 04/06/2014, 14:30
... reaction was incubated for 10–12 at 25 °C for Tic22 and MGD1 and for pSSU Overexpression and purification of pOE33-His6, mOE33-His6 and Toc34DTM-His6 for competition experiments Transformed Escherichia ... chloroplasts corresponding to 15 lg chlorophyll Import reaction was performed for 12 at 25 °C for pTic22 and pMGD1 and for the pSSU control After import, chloroplasts were subjected to thermolysin ... chloroplasts corresponding to 15 lg of chlorophyll The import reaction was performed for 12 at 25 °C for pTic22 and pMGD1 and for the pSSU control After import, chloroplasts were subjected to thermolysin...
Ngày tải lên: 23/03/2014, 07:20
... (INRA, Evry, France) for the GFP plasmids and Professor Colin Robinson (University of Warwick, UK) for help with in vitro import experiments We are grateful to the Royal Society for funding K.-A ... details of cloning and primers used for mutagenesis are available on request from A G Smith (University of Cambridge) Import assays into isolated chloroplasts in vitro For chloroplast import experiments ... to alanine Ó FEBS 2004 for in vitro transcription, in vitro translation and isolation of chloroplasts were as described [19] Expression of GFP-fusion constructs in vivo For transient expression...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo Y học: The C-terminal domain of perfringolysin O is an essential cholesterol-binding unit targeting to cholesterol-rich microdomains pptx
... contribute to the formation of a transmembrane pore [34,35] Although domain might play a role for pore formation, our results clearly demonstrated that the insertion of domain is not required for maintaining ... centrifuged at 9000 g for to remove undispersed lipids For kinetic analysis by the BIAcore system, 0.1 mol% of biotin-phosphatidylethanolamine (PE) was added to the lipid mixture before evaporation ... target for lysenin, which is secreted by earthworms [31] However, no tool has been reported for the detection of cholesterol in lipid rafts in living cells In this paper, to obtain a probe for targeting...
Ngày tải lên: 23/03/2014, 21:20
drug targeting, strategies, principles, and applications
... pyridyl disulfide-modified form until just before use The thiol group is very reactive and unwanted conjugations will result if the thiol form is allowed to remain for any length of time in the ... microconcentrator before application to the sizing column to reduce the number of chromatographic columns that must be performed Before concentration, however, an analytical run of the reaction before and ... 7) (for the preparation of blocking reagent; see ref 27) and incubated for 24–48 h at 25°C Chemical Construction of Immunotoxins 11 Fig Reaction of an activated glycopeptide with RT to form...
Ngày tải lên: 10/04/2014, 22:17
Nanosized magnetofluorescent fe3o4–curcumin conjugate for multimodal monitoring and drug targeting
... strategies for localizing cancerous tumors will be reported in the next study [8] [9] [10] [11] [12] [13] [14] Acknowledgments [15] The authors are grateful for the financial support for this work ... nanocarrier for the delivery of curcumin to cancer cells, Carbohydrate Polymers, in press, Accepted Manuscript, doi:10.1016/j.carbpol.2010.08.008 [26] H Yu, Q Huang, Enhanced in vitro anti -cancer ... fluorescence intensity that is very important for its application as fluorescence probe for drug targeting visualization (see Section 3.3) 1289 1100 assigned for symmetric (COO− ) stretches was pronounced...
Ngày tải lên: 02/07/2014, 14:14
Báo cáo y học: "Nonimmunoglobulin E–Mediated Immune Reactions to Foods" pptx
... when testing for IgE-mediated processes rather than for T cell–mediated processes (hours, for example, for FPIES) Once the top dose is reached, the observation period varies: 2.5 hours for IgEmediated ... therefore requires skill in interpretation.38 However, progress in standardization is occurring; the typical application is for 48 hours, and results are read 24 hours later 83 The European Task Force ... addition, fewer laboratory diagnostic tools exist for non–IgE-mediated disorders than for IgE-mediated reactions Food patch testing has been studied for AD, EE, Heiner’s syndrome, and (recently)...
Ngày tải lên: 08/08/2014, 21:20
báo cáo khoa học: "Adenovirus-mediated siRNA targeting Bcl-xL inhibits proliferation, reduces invasion and enhances radiosensitivity of human colorectal cancer cells" ppt
... amplification conditions were as follows: denaturation at 94℃ for 15 min; 40 cycles of 94℃ for 40 s, 56℃ (for Bcl-xL) and 60℃ (for GAPDH) for min, 72℃ for min; and a final 10 extension at 72℃ The PCR products ... used were as follows: for Bcl-xL, 5’- CCCAGAAAGGATACAGCTGG -3’ (forward), 5’- GCGATCCGACTCACCAATAC -3’ (reverse); and for GAPDH (internal control), 5’-GAAGGTGAAGGTCGGATGC-3’ (forward), 5’-GAAGATGGTGATGGGATTTC-3’ ... reported that Bcl-xL is overexpressed in many human cancers such as gastric cancer, hepatocelluar cancer, prostate carcinoma, osteosarcoma, breast cancer, etc [4-8] Previously, we have reported that...
Ngày tải lên: 09/08/2014, 02:21
Báo cáo y học: "CD134 as target for specific drug delivery to T cells in adjuvant arthritis" pps
... per group for t = 7, n = to rats per group for t = 10, n = to rats per group for t = 14, n = to rats per group for t = 21, and n = to rats per group for t = 35 *P < 0.05 compared with t = 0, **P ... measured For analysis of the interaction of CD4+ T cells and liposomes by confocal microscopy, activated A2b cells were incubated with 50 nmol of the different liposomal formulations in medium for ... Diego, California, USA) For statistical analysis of CD134 expression in vivo and liposomal drug delivery in vitro, a one-way analysis of variance with Dunnett's post-hoc test was used For analysis...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Magnetically retainable microparticles for drug delivery to the joint: efficacy studies in an antigen-induced arthritis model in mice" doc
... per group, Page of 10 (page number not for citation purposes) was necessary for at least two reasons First, there was a need to perform these control tests for the correct evaluation of the action ... magnet was compared by means of in vivo imaging For this long-term study, we used a dye covalently bound to the polymer chain PLGA-tetramethylrhodamine For technical reasons, the magnet was maintained ... coagulate for at least 30 minutes prior to centrifugation at 4,000 revolutions per minute to collect the serum The knees were dissected, fixed with 4% formaldehyde in PBS and used for histological...
Ngày tải lên: 09/08/2014, 14:20
báo cáo khoa học: "Reactive oxygen species-mediated apoptosis contributes to chemosensitization effect of saikosaponins on cisplatin-induced cytotoxicity in cancer cells" pdf
... efforts have been made to improve the anticancer value of cisplatin [14-17] Naturally occurring compounds from diets or medicinal plants are good candidates for increasing cisplatin’s anticancer ... in cancer cells The combination of saikosaponins and cisplatin could greatly improve the sensitivity of cancer cells to cisplatin Combination with agents that sensitize cancer cell to chemotherapeutics ... for the treatment of soft tissue sarcoma Clin Cancer Res 2009, 15(10):3472-83 16 Sun Q, Sakaida T, Yue W, Gollin SM, Yu J: Chemosensitization of head and neck cancer cells by PUMA Molecular cancer...
Ngày tải lên: 10/08/2014, 10:20
báo cáo khoa học: " The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model" pps
... distribution programs For example, the monthly statistics form for needle distribution from the VCH carries an official "performance target" of 90% written at the top of the form The separation ... first to know, for example, if there is a "bad" batch of drugs on the street, if there is a new hotspot for used syringes, and what the specific needs are for themselves as users and for their peers ... lays open healthcare programs like needle distribution for public debate in forums as part of the municipal process In these cumbersome public forums, healthcare is politicized as opponents to needle...
Ngày tải lên: 11/08/2014, 18:21
Báo cáo sinh học: " Anti-metastatic effects of viral and non-viral mediated Nk4 delivery to tumours" doc
... clinical implications in cancer Crit Rev Oncol Hematol 1999, 29:209-248 Matsumoto K, Nakamura T: NK4 (HGF-antagonist/angiogenesis inhibitor) in cancer biology and therapeutics Cancer Sci 2003, 94:321-327 ... vectors in cancer immunotherapy: which vector for which strategy? Curr Gene Ther 2008, 8:66-78 Merriman RL, Shackelford KA, Tanzer LR, Campbell JB, Bemis KG, Matsumoto K: Drug treatments for metastasis ... vectors have been utilised for Nk4 gene therapy of cancer [9-11], the short lived expression in tumours associated with these vectors may Page of (page number not for citation purposes) Genetic...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo y học: "Custom astrocyte-mediated vasomotor responses to neuronal energy demand" pptx
... physiological PO2 in brain slices Determination of where the switch point for dilation is may rest with characterizing how low PO2 must fall before ATP production is compromised and adenosine accumulates ... neurotransmission and provides a potential TCA substrate for synthesis of γ-aminobutyric acid and production of ATP Lactate is also shuttled from astrocytes to neurons for use as an oxidative fuel Lactate increases ... released and taken up by neuronal amino acid transporters for re-synthesis of glutamate and/or γ-aminobutyric acid via the TCA cycle For astrocyte changes in blood flow, mGluR activation causes...
Ngày tải lên: 14/08/2014, 21:20
Advanced control strategies for automatic drug delivery to regulate anesthesia during surgery
... 113 5.8 Performance of MEC controller for 17 patients 114 5.9 Performance of PID controller for 17 patients 115 5.10 IAE for all the 17 patients for set-point change ... and PID controllers for the Marsh model 108 5.6 Performance of MPC controller for 17 patients 112 5.7 Performance of IMC controller for 17 patients ... Page 6.8 Performance of MPC and PID for sensitive and insensitive patients for the set-point changes during the maintenance period 163 6.9 Average performance of MPC and PID for the set-point...
Ngày tải lên: 14/09/2015, 08:25
Báo cáo sinh học: " In vivo transcriptional targeting into the retinal vasculature using recombinant baculovirus carrying the human flt-1 promoter" potx
... quickly dissected and fixed in 4% paraformaldehyde-PBS (pH = 7.4) for hours and then placed in 10% sucrose for hours, 20% sucrose for overnight, and 30% sucrose for days The tissue was then embedded ... centrifugation at 6,000 g for 15 at 4°C The supernatants obtained were titered by plaque assay on Sf9 insect cells, stored at 4°C and used for in vitro experiments In the experiments for gene transfer ... µl/g body weight i.p.) for intravitreal injection of recombinant baculovirus In vivo Gene Transfer For in vivo viral delivery, rats were anesthetized, and their eyes were perforated with a 29-gauge...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " In vivo transcriptional targeting into the retinal vasculature using recombinant baculovirus carrying the human flt-1 promoter" docx
... quickly dissected and fixed in 4% paraformaldehyde-PBS (pH = 7.4) for hours and then placed in 10% sucrose for hours, 20% sucrose for overnight, and 30% sucrose for days The tissue was then embedded ... centrifugation at 6,000 g for 15 at 4°C The supernatants obtained were titered by plaque assay on Sf9 insect cells, stored at 4°C and used for in vitro experiments In the experiments for gene transfer ... µl/g body weight i.p.) for intravitreal injection of recombinant baculovirus In vivo Gene Transfer For in vivo viral delivery, rats were anesthetized, and their eyes were perforated with a 29-gauge...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: "Blood autoantibody and cytokine profiles predict response to anti-tumor necrosis factor therapy in rheumatoid arthriti" pps
... pretreatment samples was performed for the present study Response to therapy with etanercept was assessed at least months after etanercept was started, based on the ACR criteria for improvement [2] All ... the Stanford research laboratory, and separate aliquots were used for each assay to minimize the effects of additional freeze- thaw cycles Cytokine assay All cytokine measurements were performed ... described in detail [12] For the studies performed herein, we utilized a custom 12-plex human cytokine FLEX® kit (Upstate, Millipore, Billerica, MA, USA) that included beads specific for TNFα, IL-1α,...
Ngày tải lên: 09/08/2014, 14:21
Tài liệu Báo cáo khoa học: Steady-state and time-resolved fluorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli ppt
... staining For spectrophotometric determination of concentrations, the following absorption coefcients were used: 14 650 )1 )1 M ặcm at 259 nm for cAMP [16] and 6000 M)1ặcm)1 at ể FEBS 2003 Conformational ... determined to be 0.09 for mutant CRPW13F alone and 0.094 for mutant CRPW13F in the presence of 200 lM cAMP The quantum yield of the donor increased upon proteinDNA complex formation The change ... energy transfer The value for CRPW13F with two cAMP molecules bound to anticAMP-binding sites was considerably higher (72.3 2.5%) than for apoprotein The result determined for the mutant W13F in...
Ngày tải lên: 20/02/2014, 23:20