... compensate against signal fluctuations in fading channels to have a steady signal strength Multiple antennas provide independent signal paths on so-called space diversity Each pair of transmit and ... constant Rayleigh flat-fading channel [4] where the fading gains are i.i.d complex Gaussian distributed and remain constant for T symbol periods before changing to a new independent realization, ... BEP performance Therefore trellis coding with parallel paths is a tradeoff between decoding complexity and the coding gains Another reason that we set out from trellis coding with parallel paths...
Ngày tải lên: 11/09/2015, 14:38
... objectives Settling for a cheap and amateurish site will devalue your business and can more harm to your professional image and reputation than not having a Web site at all Remember: Building a Web site ... and park your domain name for safekeeping, but are not ready to subscribe to a Web site hosting package, the following table can be used to evaluate potential domain name registrars separately ... E-mail Chat (IM) Availability (i.e 24/7, business hours) Average turnaround time To avoid the administration hassles of having to deal with a separate Web site host and domain name registrar, register...
Ngày tải lên: 20/08/2012, 11:43
The Practical Guidelines for Building a Business Plan in Five Pages
... implementing, and sustaining Each phase has a unique and powerful place in the planning cycle Figure 2-6 The business planning cycle has four phases Building a Business Plan in Five Pages 39 Phase ... company for example, a labor strike in a plant that was not expected or anticipated that catches management unprepared A contingency plan should address such occurrences Natural disasters are a ... providing the education and training necessary to support the finished goals? 55 Building a Business Plan in Five Pages THE PRACTICAL APPLICATIONS: BEGINNING A SUCCESSFUL PLANNING CYCLE By following...
Ngày tải lên: 24/10/2013, 09:20
Creating a Web Service
... mySqlConnection.CreateCommand(); mySqlCommand.CommandText = selectString; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); ... the Northwind database and returns a DataSet containing rows from the Customers table You pass a WHERE clause to the RetrieveCustomers() method in the whereClause parameter; this WHERE clause is ... Northwind database Because the code uses classes in the System.Data.SqlClient namespace, you'll also need to add the following line near the top of your Customers.asmx.cs file: using System.Data.SqlClient;...
Ngày tải lên: 28/10/2013, 19:15
Tài liệu XML, XSLT, Java, and JSP: A Case Study in Developing a Web Application- P8 pdf
... steps required for either Xalan-Java or Xalan-Java 2.The classes are called Xalan1Transformer and Xalan2Transformer Each has one method called transform, which returns a string containing the results ... looks for an attribute in application scope, also named xalanVersion, and uses its value to select the processor At present, only Xalan Java and Xalan Java are valid values for xalanVersion The inXML ... XML data.That is what it’s for, after all! Certainly, it would have been easier to keep all the data in an SQL database and use JDBC connections and SQL queries (tag library are already available)...
Ngày tải lên: 14/12/2013, 22:15
Tài liệu 10 Tips for Creating Your Web Site ppt
... cutting-edge, interactive web sites From opening windows to image-flipping and form validation, Javascript can help you build exciting, dynamic web pages Integrating HTML, JavaScript, and Cascading Style ... testing against each one, and more one of creating web pages that are useful, accessible, and exciting There are a vast number of resources on the web to help improve web sites For information about ... XHTML standards, as well as help with Cascading Style Sheets and DOM Scripting (using JavaScript to make your web pages more dynamic), the W3C pages (http://www.w3.org) are invaluable They include...
Ngày tải lên: 21/12/2013, 04:18
Tài liệu XML, XSLT, Java, and JSP: A Case Study in Developing a Web Application- P12 pdf
... 6/26/01 7:40 AM Page 544 544 Appendix C Source Code for bonForum Web Application * @param pathName String * @param pathNameHashtable PathNameHashtable * @param forestHashtable ForestHashtable * @return ... public class BonForumTagExtraInfo extends TagExtraInfo { public VariableInfo[] getVariableInfo(TagData data) { return new VariableInfo[] { new VariableInfo(“output”, “String”, true, VariableInfo.NESTED), ... for each element in the “subjects” subtree * is also in a pathNameHashtable, with a pathName key) * * @param pathName String * @param pathNameHashtable PathNameHashtable * @return NodeKey for...
Ngày tải lên: 24/12/2013, 07:17
Tài liệu Editing and Updating Data in a Web Forms DataGrid pdf
... if( !Page. IsPostBack) { dataGrid.DataSource = CreateDataSource( ); dataGrid.DataKeyField = "Id"; dataGrid.DataBind( ); } private DataTable CreateDataSource( ) { DataTable dt = new DataTable(TABLENAME); // Create ... UpdateDataSource(DataTable dt) { // Create a DataAdapter for the update SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME + " ORDER BY Id", ConfigurationSettings.AppSettings["DataConnectString"]); ... the DataAdapter and fill the table using it SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME + " ORDER BY Id", ConfigurationSettings.AppSettings["DataConnectString"]); da.Fill(dt);...
Ngày tải lên: 26/01/2014, 10:20
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease
... Joomla! 1.6 Admin control panel Each icon opens to a dedicated administration area of the back-end Alternate Administrator Access You can access additional areas of the administrator back-end using ... Install the Sample Data Figure 1-8 Enter information about the administrator and password for access Click the Install Sample Data button before clicking Save Be Aware of Default Usernames Hackers ... domain name and select a hosting company You probably already have a domain name in mind, so purchasing that is a first step Domain names, beyond their initial cost, have a small annual fee you...
Ngày tải lên: 29/05/2014, 23:54
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... A/ Ann Arbor/6/60 Chicken Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila ... production of influenza vaccines for human vaccination is in most cases an egg-base process, many vaccine manufacturers are actively developing cell-based influenza vaccine capabilities Cell-based influenza...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... A/ Ann Arbor/6/60 Chicken Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila ... production of influenza vaccines for human vaccination is in most cases an egg-base process, many vaccine manufacturers are actively developing cell-based influenza vaccine capabilities Cell-based influenza...
Ngày tải lên: 20/06/2014, 01:20
5 Tips for Creating a Team Building Culture at Work pdf
... Communicating a clear vision of the future is crucial Engaged employees require a work culture that is fundamentally stimulating, a return on the investment they are making in your company and leadership ... While individual achievements are great, collaborative ideas and practices are what create a team-building culture Encourage team members to work together to come up with the very best ideas, and ... matching, and then empower your managers to use this data, you will accelerate performance and build your employee brand loyalty It’s also important to remember that team building isn’t just an activity...
Ngày tải lên: 28/06/2014, 13:20
Báo cáo y học: "Colour duplex sonography of temporal arteries before decision for biopsy: a prospective study in 55 patients with suspected giant cell arteritis" pptx
... examination Discussion A careful physical examination, including palpation of the temporal arteries, accompanied by an accurate medical history Page of (page number not for citation purposes) Available ... granulomatosis; Table 2), a unilateral halo sign was found in CDS In the first case, a vein neighbouring an artery was mistaken for a halo; the final diagnosis was a flu-like syndrome In the second case, ... mm and in one case approached 2.0 mm The halo sign was either a unilateral or a bilateral finding in 12 and patients, respectively (Table 2) No Figure Parietal ramus of a normal temporal artery...
Ngày tải lên: 09/08/2014, 08:22
valuation for m a Building Value in private companies phần 1 pot
... CHAPTER Valuation Approaches and Fundamentals Business Valuation Approaches Using the Invested Capital Model to Define the Investment Being Appraised Why Net Cash Flow Measures Value Most Accurately ... concepts and techniques that follow explain how to measure and manage value on a daily basis and particularly in M &A The discussion begins with an understanding of what value is CRITICAL VALUES SHAREHOLDERS ... technological innovations, or regulatory and tax reforms also can expand or contract M &A opportunities and value Procrastination also can hamper estate planning and tax strategies because delays reduce...
Ngày tải lên: 14/08/2014, 05:21
valuation for m a Building Value in private companies phần 2 potx
... Distribution capability Depth, accuracy, and timeliness of accounting information and internal control Although business valuation involves many financial calculations, it is not primarily a financial activity, ... essential step Many people see valuation as primarily a financial calculation They analyze historical financial performance, position and cash flow, compute financial ratios, and compare them to industry ... competitive analysis to assess a company’s strategic position and ability to compete in its market against its peers LINKING STRATEGIC PLANNING TO BUILDING VALUE Companies engage in annual strategic planning...
Ngày tải lên: 14/08/2014, 05:21
valuation for m a Building Value in private companies phần 3 pot
... personal and financial goals that, if reached in a rational and systematic manner, simply represents sound management • Prepare the company for sale Many of the details in the preparation and sale process ... physically, from repair and maintenance to painting and landscaping — Maintain confidentiality while negotiating contracts or less formal agreements to keep key employees — Rely on the intermediary ... capabilities, and capacities Technological capabilities Distribution system Sales and marketing program Management capabilities Sales Strategy and Process 59 • Financial position and historical performance...
Ngày tải lên: 14/08/2014, 05:21
valuation for m a Building Value in private companies phần 4 docx
... Risk management techniques are also available for use in valuation for M &A Most commonly these involve traditional statistical parameters that include expected value, variance, standard deviation, ... assessing the cost of capital for a business and gauging general company and market risk, additional risk analysis tools are available M &A investment decisions, with appropriate computation of rates ... sustainable performance Also, the growth rate, g, must be a realistic expectation of that company’s ability to achieve annual growth in that return to infinity Where material variations in annual...
Ngày tải lên: 14/08/2014, 05:21
valuation for m a Building Value in private companies phần 5 docx
... rates that suggest a company will maintain its competitive advantages forever For example, in an industry that is growing at an annual rate of 3%, an SPCM or MPDM computation that includes a ... of Capital Essentials for Accurate Valuations The cost of capital is always an expectational or forward-looking concept While the past performance of an investment and other historical information ... which in the process generally improves the information that is available to their management Such data is frequently lacking in smaller businesses, a fact that may hamper management’s assessment...
Ngày tải lên: 14/08/2014, 05:21
valuation for m a Building Value in private companies phần 6 ppsx
... constitute a market and that adequate data about those transactions can be obtained to permit a thorough analysis In the process of gathering and analyzing this information, much useful information can ... transaction data is that it reveals information about what well-informed strategic players in an industry are doing and the prices they have paid in strategic transactions When adequate information ... yield an appropriate indication of value, the transactional data must relate to companies that are reasonably similar to the target being valued In addition, the synergies anticipated in the acquisition...
Ngày tải lên: 14/08/2014, 05:21
valuation for m a Building Value in private companies phần 7 pot
... defendable based on conditions as of the appraisal date and the quality and quantity of information available? Because there are many qualitative assessments and quantitative steps leading to the initial ... method and involves the following five steps: Beginning point Obtain the target’s balance sheet as of the appraisal date or as recently before that date as possible (Audited financial statements are ... of marketability inherent in the interest being valued? For example, if the guideline public company method generates an initial indication of value on a minority marketable basis and a minority...
Ngày tải lên: 14/08/2014, 05:21